Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 333

17 members and 316 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 65,239
Threads: 239,905
Posts: 2,492,468
Top Poster: JLC (31,652)
Welcome to our newest member, Hmp5959
Page 2 of 2 FirstFirst 12
Results 11 to 12 of 12
  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    791
    Thanks
    80
    Thanked 550 Times in 304 Posts

    Re: Blacklight on a BEL to see what its hiding?

    Quote Originally Posted by Aziara View Post
    I suppose the reason I came to the idea that SuperFire would be mostly white...
    My comment was directed to Ruf, hence why I quoted him
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #12
    Registered User
    Join Date
    11-03-2007
    Posts
    66
    Thanks
    0
    Thanked 33 Times in 12 Posts

    Re: Blacklight on a BEL to see what its hiding?

    A stark white lucy is on my list of goals also. I have a great looking superfly male but I'll be looking for a brite/lucifer/sauce/lemonback to pair with him. From my reading on the subject those produce the best BlkELs, while most "standard" fires in super form have some tan spots. I also have a mojave x butter that I'll be pairing up eventually to get a BluEL. I really like what Albey started doing with the Sauce and Hot Sauce snakes but they don't seem very available, and the Lucifers and Lemonbacks are pretty rare as well, mostly coming from NERD in combination with other genes.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1