Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,352

1 members and 1,351 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,533
Posts: 2,568,689
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Page 2 of 2 FirstFirst 12
Results 11 to 12 of 12
  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Blacklight on a BEL to see what its hiding?

    Quote Originally Posted by Aziara View Post
    I suppose the reason I came to the idea that SuperFire would be mostly white...
    My comment was directed to Ruf, hence why I quoted him
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #12
    Registered User
    Join Date
    11-03-2007
    Posts
    73
    Thanks
    0
    Thanked 35 Times in 14 Posts

    Re: Blacklight on a BEL to see what its hiding?

    A stark white lucy is on my list of goals also. I have a great looking superfly male but I'll be looking for a brite/lucifer/sauce/lemonback to pair with him. From my reading on the subject those produce the best BlkELs, while most "standard" fires in super form have some tan spots. I also have a mojave x butter that I'll be pairing up eventually to get a BluEL. I really like what Albey started doing with the Sauce and Hot Sauce snakes but they don't seem very available, and the Lucifers and Lemonbacks are pretty rare as well, mostly coming from NERD in combination with other genes.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1