Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,386

0 members and 1,386 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,532
Posts: 2,568,688
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Results 1 to 5 of 5

Thread: BEL question

  1. #1
    Registered User
    Join Date
    07-05-2019
    Posts
    5
    Thanks
    0
    Thanked 0 Times in 0 Posts

    BEL question

    Hello everyone, this is my first post here

    I'm buying a lesser mojave from a breeder and he said there's lots of variability in how they can turn out. However, he also said that it'll probably look like the mother (also a BEL) does (with a light yellow stripe on the back). All this has made me a bit confused on what the snake will actually look like as it grows up, lol. I figured I'd ask here. Thank you in advance!

  2. #2
    Registered User KKM's Avatar
    Join Date
    09-01-2017
    Location
    San Diego, CA
    Posts
    31
    Thanks
    15
    Thanked 18 Times in 11 Posts
    In general, lesser mojaves tend to be pretty white. There is a good chance it’ll develop a faint yellow stripe, though, as most seem to by the time they’re adults. While not as white as a super lesser/butter, you avoid the eye issues and still get a pretty darn white snake. I’m not sure if you’ve seen this already, but here are some photos of different stages of lesser mojaves: http://www.worldofballpythons.com/morphs/lesser-mojave/
    1.1 ball pythons, 2.0 BCIs, 1.0 western hognose, 1.0 honduran milk, 1.0 corn snake, 1.0 kenyan sand boa, 1.0 pueblan milk, 1.0 MBK, 1.0 checkered garter, 1.0 eastern garter, 1.0 coast garter, 1.0 plains garter

  3. The Following User Says Thank You to KKM For This Useful Post:

    dr del (07-10-2019)

  4. #3
    Registered User
    Join Date
    07-05-2019
    Posts
    5
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: BEL question

    Is that a sure thing? Because he told me it depends on the snake and he's produced some with amazing white stripes all over. I haven't seen a lesser mojave with white stripes so I'm unsure what he meant by that. Since the mom has a yellow stripe down her back, but the dad is also putting his genes in, how would that factor into it? Sorry if I'm asking obvious questions here, I'm very new to all this

    Edit: I believe the dad is a leopard mojave
    Last edited by Evening; 07-11-2019 at 08:03 PM.

  5. #4
    BPnet Senior Member
    Join Date
    02-20-2010
    Location
    United States
    Posts
    1,022
    Thanks
    312
    Thanked 906 Times in 405 Posts
    Images: 43

    Re: BEL question

    My female butter mojave pos. pastel, also has a slight yellow stripe, I think its pretty common for that kind of bel. Its hard to see but here is my girl, her stripe is very faint. Also included a pic of her as a hatchling, the stripe wasn't as visible when she was that small.


    Sent from my LGL164VL using Tapatalk
    Last edited by Alexiel03; 07-14-2019 at 06:28 PM.

  6. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Over a decade in this hobby has shown me that most all BluEL combinations yellow out to some extent becoming less white and more cream and they also tend develop a visible dorsal stripe. The all-white Pied BluELs are stark white but you run into the microphthalmia problem with them.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    PitOnTheProwl (07-16-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1