Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 338

9 members and 329 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 65,239
Threads: 239,906
Posts: 2,492,475
Top Poster: JLC (31,652)
Welcome to our newest member, Hmp5959
Results 1 to 8 of 8

Thread: BEL differences

  1. #1
    Registered User KKM's Avatar
    Join Date
    09-01-2017
    Location
    San Diego, CA
    Posts
    31
    Thanks
    15
    Thanked 18 Times in 11 Posts

    BEL differences

    I know this is asked a lot but most of the threads Iíve seen about it are outdated in terms of the genes that are available. I was under the impression that lesser/butter, russo, and mojave (sort of) were the only ways to get a pure while BEL, but Iíve been seeing some other morphs recently that look the same but have different names (bamboo etc). Are these actually new, or like lesser/butter in that theyíre the same gene as another morph but a different line? Also, which combination makes the cleanest BEL? Iíve heard super lesser/butter but I have yet to see one in person. Most of the lesser mojaves Iíve seen have some sort of light shading from the mojave, but perhaps I just havenít seen a good one. How do super russos compare to the others? Thatís what I have and I think heís pretty darn white, but again that could be due to my limited exposure to different BELs. Also, do other genes (spider, pastel, etc) coupled with BEL enhance or detract from their whiteness?

    I know these are kind of subjective questions but Iím just curious as to what the 2019 consensus on this is
    2.0 BCIs, 2.0 plains garters, 1.0 ball python, 1.0 western hognose, 1.0 honduran milk, 1.0 carpet python, 1.0 corn snake, 1.0 kenyan sand boa, 1.0 pueblan milk, 1.0 mexican black king, 1.0 black milk, 1.0 checkered garter, 1.0 eastern garter

  2. The Following User Says Thank You to KKM For This Useful Post:

    wonderfvl (07-04-2019)

  3. #2
    Registered User RedRabbit's Avatar
    Join Date
    11-04-2018
    Location
    Southern California
    Posts
    290
    Thanks
    159
    Thanked 408 Times in 183 Posts
    Images: 30
    First off, hi there, fellow Southern Californian!

    Here's one of the more comprehensive lists I've seen of all the genes in the BEL complex: https://www.belgiandesignermorphs.co...n/bel-complex/

    I also had the exact same question you did in one of my past threads, when I was getting ready to buy my BEL. It got a lot of helpful responses and example owner pics of different BEL gene combos: https://ball-pythons.net/forums/show...ue-eyed-lucies!

    I think the general consensus was, like you said, that Super Lesser or Super Butter had the best chance of resulting in a BEL that stays clean white into adulthood. My own boy, Rae, is a Butter Mojave, and he's staying solid white so far, but he's only going on a year old, so time will tell, and I'll love him anyway, haha. Here's one of my more recent photos of him:



    And if your userpic is any indication, your Super Russo is looking fantastic so far!
    Ball Pythons:
    2018 Cinnamon Enchi Ghost - Ignis ("Iggy")
    2018 Butter Mojave BEL - Ravus ("Rae")

    Boa Imperator:
    2018 Hypo Blood - Genesis ("Gen")
    2019 IMG Motley - Requiem ("Q")

    Iggy&Rae on Instagram:
    https://www.instagram.com/iggy_and_rae

  4. The Following 5 Users Say Thank You to RedRabbit For This Useful Post:

    Burticus (07-06-2019),KKM (07-05-2019),PartySnake13 (07-09-2019),the_rotten1 (07-04-2019),wonderfvl (07-04-2019)

  5. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    791
    Thanks
    80
    Thanked 550 Times in 304 Posts
    The BluEL complex is quite large:

    Butter/Lesser
    Bamboo
    Mojave
    Russo
    Mocha
    Phantom/Mystic
    Special (all three lines)
    het Daddy


    As far as "whitest" BluEL. You will get a handful of different answers and all of them are subjective. Over a decade in this hobby has shown me that most all BluEL combinations yellow out to some extent becoming less white and more cream and they also tend develop a visible dorsal stripe. The all-white Pied BluELs are stark white but you run into the microphthalmia problem with them.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #4
    Registered User
    Join Date
    11-03-2007
    Posts
    66
    Thanks
    0
    Thanked 33 Times in 12 Posts
    Can a Lesser Mojave pass both genes? As in, if bred to normal, could you get a lesser, mojave, BEL, or normal as a result?

  7. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    791
    Thanks
    80
    Thanked 550 Times in 304 Posts

    Re: BEL differences

    Quote Originally Posted by drew5337 View Post
    Can a Lesser Mojave pass both genes? As in, if bred to normal, could you get a lesser, mojave, BEL, or normal as a result?
    No. You will only get Lessers and/or Mojaves from the clutch.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #6
    Registered User Commander's Balls's Avatar
    Join Date
    07-14-2019
    Posts
    21
    Thanks
    1
    Thanked 8 Times in 6 Posts

    Re: BEL differences

    Quote Originally Posted by asplundii View Post
    No. You will only get Lessers and/or Mojaves from the clutch.
    This is due to the Gene's falling on the same allele. Basically what happens in a super, like the bel complex, is the two genes fit on the same spot and due to this only one or the other is passed on.

    Sent from my SM-G965U using Tapatalk

  9. #7
    Registered User
    Join Date
    11-03-2007
    Posts
    66
    Thanks
    0
    Thanked 33 Times in 12 Posts

    Re: BEL differences

    Quote Originally Posted by Commander's Balls View Post
    This is due to the Gene's falling on the same allele. Basically what happens in a super, like the bel complex, is the two genes fit on the same spot and due to this only one or the other is passed on.

    Sent from my SM-G965U using Tapatalk
    Thats what I thought but I was overthinking it to myself.

  10. #8
    Registered User Commander's Balls's Avatar
    Join Date
    07-14-2019
    Posts
    21
    Thanks
    1
    Thanked 8 Times in 6 Posts

    Re: BEL differences

    Quote Originally Posted by drew5337 View Post
    Thats what I thought but I was overthinking it to myself.
    Easy to do. There is so much information it's hard to just sit down and simplify things

    let's get the ball rollin'

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1