Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 365

14 members and 351 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 64,923
Threads: 239,490
Posts: 2,488,370
Top Poster: JLC (31,652)
Welcome to our newest member, xxytxx
Page 2 of 2 FirstFirst 12
Results 11 to 17 of 17
  1. #11
    Registered User
    Join Date
    10-20-2017
    Posts
    28
    Thanks
    3
    Thanked 13 Times in 9 Posts

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by Alexiel03 View Post
    Here is what I think they are:
    Lesser bee
    Pastave
    Spider
    Bumblebee
    Pastels

    If I'm wrong I'm sure someone will correct me lol

    Sent from my LGL164VL using Tapatalk
    I would agree but with mum being a BEL, and most are thinking Lesser Mojave) then all offspring must either be lesser or Mojave


    Sent from my iPhone using Tapatalk

  2. #12
    BPnet Veteran Alexiel03's Avatar
    Join Date
    02-20-2010
    Location
    United States
    Posts
    743
    Thanks
    168
    Thanked 550 Times in 251 Posts
    Images: 43

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by Marwan View Post
    I would agree but with mum being a BEL, and most are thinking Lesser Mojave) then all offspring must either be lesser or Mojave


    Sent from my iPhone using Tapatalk
    True. Then this would probably be a more accurate guess:

    Lesser bee
    Pastave or lesser pastel
    Mojave spider
    Mojave bumblebee
    Pastaves

    Only thing I think is weird is that the one I previous though to be a bumblebee does not look like it has either mojave or lesser in it, looks like a regular bee to me.

    Sent from my LGL164VL using Tapatalk
    Last edited by Alexiel03; 06-19-2019 at 01:56 PM.

    Bps:
    0.1 Mojave BP (Liliana)
    0.1 Firefly BP (Chandra)
    0.1 Pastel GHI
    0.1 Pied 50% het Ghost
    0.1 Leopard Mojave
    0.1 Orange Dream Fire Yellowbelly
    0.1 Sugar Spider
    0.1 Desert Ghost
    0.1 Lesser 66% het Orange Ghost
    1.0 Fire Bee (Garruk)
    1.0 Leopard BP (Ajani)
    1.0 Butter Pastel BP (Diesel)
    1.0 Banana Pastel Enchi
    1.0 Lemon Pastel Enchi

    Non BPs:
    1.0 Sunfire Retic (Helios)R.I.P.
    1.0 Albino Burmese Python (Slayer)
    0.1 Normal het Granite Burmese Python (Pandora)
    0.2 Calico Cats (Mana and Elizabeth)
    0.1 Dog (pitbull lab mix) (Nova)

  3. #13
    Registered User
    Join Date
    10-20-2017
    Posts
    28
    Thanks
    3
    Thanked 13 Times in 9 Posts

    Re: Help identifying bel complex hatchlings

    What Iím currently thinking is the following.

    - Queen Bee
    - Pastave
    - Spider Mojave (Spider lessers are very distinctive)
    - Pastave bee (Mojave Spider Pastel)
    - Pastel Lesser?????? ( really donít think so because again Pastel lessers are very distinctive but the donít look like Pastaves either)

    This is where Iím beginning to think that perhaps she may not be a Lesser Mojave but then again like I said she produced 3 fire lessers (or so we still think they are) with a Super Fire last year. This guarantees at least Lesser is involved in her genetics but not sure of what else


    Sent from my iPhone using Tapatalk

  4. #14
    Registered User
    Join Date
    10-20-2017
    Posts
    28
    Thanks
    3
    Thanked 13 Times in 9 Posts

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by Alexiel03 View Post
    True. Then this would probably be a more accurate guess:

    Lesser bee
    Pastave
    Mojave spider
    Mojave bumblebee
    Pastaves

    Only thing I think is weird is that the one I previous though to be a bumblebee does not look like it has either mojave or lesser in it, looks like a regular bee to me.

    Sent from my LGL164VL using Tapatalk
    Again agreed. That one along with the last two seem to be bumblebees and pastels however thatís not possible if produced from a BEL.

    This is mum in case it helps anyone at all with all of this




    Sent from my iPhone using Tapatalk

  5. #15
    Sometimes It Hurts... PitOnTheProwl's Avatar
    Join Date
    11-21-2010
    Location
    San Antonio, TX
    Posts
    11,990
    Thanks
    6,155
    Thanked 6,869 Times in 4,214 Posts
    Images: 3

    Re: Help identifying bel complex hatchlings

    All depends on her....
    This BEL came from a Pastel Lesser to a female Mojave....
    Need a little more weight on her to prove out if she is a 2 gene or 3.....


    Dont have any recent photos at the time..
    Sent from my SM-G965U using Tapatalk
    Last edited by PitOnTheProwl; 06-19-2019 at 07:37 PM.

  6. #16
    BPnet Veteran Alexiel03's Avatar
    Join Date
    02-20-2010
    Location
    United States
    Posts
    743
    Thanks
    168
    Thanked 550 Times in 251 Posts
    Images: 43

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by PitOnTheProwl View Post
    All depends on her....
    This BEL came from a Pastel Lesser to a female Mojave....
    Need a little more weight on her to prove out if she is a 2 gene or 3.....


    Dont have any recent photos at the time..
    Sent from my SM-G965U using Tapatalk
    Maybe his bel has pastel in it?

    Im in the same boat as you lol This is my bel, she came from a mojave x butter pastel clutch. I also need to prove her out to see if she's carrying the pastel trait. She should be ready to breed this fall hopefully

    Sent from my LGL164VL using Tapatalk

    Bps:
    0.1 Mojave BP (Liliana)
    0.1 Firefly BP (Chandra)
    0.1 Pastel GHI
    0.1 Pied 50% het Ghost
    0.1 Leopard Mojave
    0.1 Orange Dream Fire Yellowbelly
    0.1 Sugar Spider
    0.1 Desert Ghost
    0.1 Lesser 66% het Orange Ghost
    1.0 Fire Bee (Garruk)
    1.0 Leopard BP (Ajani)
    1.0 Butter Pastel BP (Diesel)
    1.0 Banana Pastel Enchi
    1.0 Lemon Pastel Enchi

    Non BPs:
    1.0 Sunfire Retic (Helios)R.I.P.
    1.0 Albino Burmese Python (Slayer)
    0.1 Normal het Granite Burmese Python (Pandora)
    0.2 Calico Cats (Mana and Elizabeth)
    0.1 Dog (pitbull lab mix) (Nova)

  7. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    776
    Thanks
    80
    Thanked 529 Times in 292 Posts

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by Marwan View Post
    This is where Iím beginning to think that perhaps she may not be a Lesser Mojave but then again like I said she produced 3 fire lessers (or so we still think they are) with a Super Fire last year. This guarantees at least Lesser is involved in her genetics
    I am inclined to agree with you. My guess is that your BluEL is more likely a Lesser/Russo or a Lesser/Mocha and the animal that people are calling a Mojave Pastel is actually just a lower expression Lesser Pastel

    So what you have is:

    QueenBee
    Russo (or Mocha) Bee
    Russo (or Mocha) Spider
    Lesser Pastel
    Pastel Russo (or Mocha)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1