» Site Navigation
5 members and 3,015 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,533
Posts: 2,568,700
Top Poster: JLC (31,651)
|
-
Registered User
Re: Help identifying bel complex hatchlings
Originally Posted by Alexiel03
Here is what I think they are:
Lesser bee
Pastave
Spider
Bumblebee
Pastels
If I'm wrong I'm sure someone will correct me lol
Sent from my LGL164VL using Tapatalk
I would agree but with mum being a BEL, and most are thinking Lesser Mojave) then all offspring must either be lesser or Mojave
Sent from my iPhone using Tapatalk
-
-
Re: Help identifying bel complex hatchlings
Originally Posted by Marwan
I would agree but with mum being a BEL, and most are thinking Lesser Mojave) then all offspring must either be lesser or Mojave
Sent from my iPhone using Tapatalk
True. Then this would probably be a more accurate guess:
Lesser bee
Pastave or lesser pastel
Mojave spider
Mojave bumblebee
Pastaves
Only thing I think is weird is that the one I previous though to be a bumblebee does not look like it has either mojave or lesser in it, looks like a regular bee to me.
Sent from my LGL164VL using Tapatalk
Last edited by Alexiel03; 06-19-2019 at 01:56 PM.
-
-
Registered User
-
-
Registered User
Re: Help identifying bel complex hatchlings
-
-
Re: Help identifying bel complex hatchlings
All depends on her....
This BEL came from a Pastel Lesser to a female Mojave....
Need a little more weight on her to prove out if she is a 2 gene or 3.....
Dont have any recent photos at the time..
Sent from my SM-G965U using Tapatalk
Last edited by PitOnTheProwl; 06-19-2019 at 07:37 PM.
-
-
Re: Help identifying bel complex hatchlings
Originally Posted by PitOnTheProwl
All depends on her....
This BEL came from a Pastel Lesser to a female Mojave....
Need a little more weight on her to prove out if she is a 2 gene or 3.....
Dont have any recent photos at the time..
Sent from my SM-G965U using Tapatalk
Maybe his bel has pastel in it?
Im in the same boat as you lol This is my bel, she came from a mojave x butter pastel clutch. I also need to prove her out to see if she's carrying the pastel trait. She should be ready to breed this fall hopefully
Sent from my LGL164VL using Tapatalk
-
-
Re: Help identifying bel complex hatchlings
Originally Posted by Marwan
This is where I’m beginning to think that perhaps she may not be a Lesser Mojave but then again like I said she produced 3 fire lessers (or so we still think they are) with a Super Fire last year. This guarantees at least Lesser is involved in her genetics
I am inclined to agree with you. My guess is that your BluEL is more likely a Lesser/Russo or a Lesser/Mocha and the animal that people are calling a Mojave Pastel is actually just a lower expression Lesser Pastel
So what you have is:
QueenBee
Russo (or Mocha) Bee
Russo (or Mocha) Spider
Lesser Pastel
Pastel Russo (or Mocha)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|