Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,897

1 members and 2,896 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,087
Threads: 248,528
Posts: 2,568,679
Top Poster: JLC (31,651)
Welcome to our newest member, FayeZero
Page 2 of 2 FirstFirst 12
Results 11 to 17 of 17
  1. #11
    Registered User
    Join Date
    10-20-2017
    Posts
    37
    Thanks
    3
    Thanked 17 Times in 13 Posts

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by Alexiel03 View Post
    Here is what I think they are:
    Lesser bee
    Pastave
    Spider
    Bumblebee
    Pastels

    If I'm wrong I'm sure someone will correct me lol

    Sent from my LGL164VL using Tapatalk
    I would agree but with mum being a BEL, and most are thinking Lesser Mojave) then all offspring must either be lesser or Mojave


    Sent from my iPhone using Tapatalk

  2. #12
    BPnet Senior Member
    Join Date
    02-20-2010
    Location
    United States
    Posts
    1,022
    Thanks
    312
    Thanked 906 Times in 405 Posts
    Images: 43

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by Marwan View Post
    I would agree but with mum being a BEL, and most are thinking Lesser Mojave) then all offspring must either be lesser or Mojave


    Sent from my iPhone using Tapatalk
    True. Then this would probably be a more accurate guess:

    Lesser bee
    Pastave or lesser pastel
    Mojave spider
    Mojave bumblebee
    Pastaves

    Only thing I think is weird is that the one I previous though to be a bumblebee does not look like it has either mojave or lesser in it, looks like a regular bee to me.

    Sent from my LGL164VL using Tapatalk
    Last edited by Alexiel03; 06-19-2019 at 01:56 PM.

  3. #13
    Registered User
    Join Date
    10-20-2017
    Posts
    37
    Thanks
    3
    Thanked 17 Times in 13 Posts

    Re: Help identifying bel complex hatchlings

    What I’m currently thinking is the following.

    - Queen Bee
    - Pastave
    - Spider Mojave (Spider lessers are very distinctive)
    - Pastave bee (Mojave Spider Pastel)
    - Pastel Lesser?????? ( really don’t think so because again Pastel lessers are very distinctive but the don’t look like Pastaves either)

    This is where I’m beginning to think that perhaps she may not be a Lesser Mojave but then again like I said she produced 3 fire lessers (or so we still think they are) with a Super Fire last year. This guarantees at least Lesser is involved in her genetics but not sure of what else


    Sent from my iPhone using Tapatalk

  4. #14
    Registered User
    Join Date
    10-20-2017
    Posts
    37
    Thanks
    3
    Thanked 17 Times in 13 Posts

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by Alexiel03 View Post
    True. Then this would probably be a more accurate guess:

    Lesser bee
    Pastave
    Mojave spider
    Mojave bumblebee
    Pastaves

    Only thing I think is weird is that the one I previous though to be a bumblebee does not look like it has either mojave or lesser in it, looks like a regular bee to me.

    Sent from my LGL164VL using Tapatalk
    Again agreed. That one along with the last two seem to be bumblebees and pastels however that’s not possible if produced from a BEL.

    This is mum in case it helps anyone at all with all of this




    Sent from my iPhone using Tapatalk

  5. #15
    Sometimes It Hurts... PitOnTheProwl's Avatar
    Join Date
    11-21-2010
    Location
    San Antonio, TX
    Posts
    12,050
    Thanks
    6,313
    Thanked 6,985 Times in 4,274 Posts
    Images: 3

    Re: Help identifying bel complex hatchlings

    All depends on her....
    This BEL came from a Pastel Lesser to a female Mojave....
    Need a little more weight on her to prove out if she is a 2 gene or 3.....


    Dont have any recent photos at the time..
    Sent from my SM-G965U using Tapatalk
    Last edited by PitOnTheProwl; 06-19-2019 at 07:37 PM.

  6. #16
    BPnet Senior Member
    Join Date
    02-20-2010
    Location
    United States
    Posts
    1,022
    Thanks
    312
    Thanked 906 Times in 405 Posts
    Images: 43

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by PitOnTheProwl View Post
    All depends on her....
    This BEL came from a Pastel Lesser to a female Mojave....
    Need a little more weight on her to prove out if she is a 2 gene or 3.....


    Dont have any recent photos at the time..
    Sent from my SM-G965U using Tapatalk
    Maybe his bel has pastel in it?

    Im in the same boat as you lol This is my bel, she came from a mojave x butter pastel clutch. I also need to prove her out to see if she's carrying the pastel trait. She should be ready to breed this fall hopefully

    Sent from my LGL164VL using Tapatalk

  7. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by Marwan View Post
    This is where I’m beginning to think that perhaps she may not be a Lesser Mojave but then again like I said she produced 3 fire lessers (or so we still think they are) with a Super Fire last year. This guarantees at least Lesser is involved in her genetics
    I am inclined to agree with you. My guess is that your BluEL is more likely a Lesser/Russo or a Lesser/Mocha and the animal that people are calling a Mojave Pastel is actually just a lower expression Lesser Pastel

    So what you have is:

    QueenBee
    Russo (or Mocha) Bee
    Russo (or Mocha) Spider
    Lesser Pastel
    Pastel Russo (or Mocha)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1