Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 718

9 members and 709 guests
Most users ever online was 4,261, 10-01-2019 at 06:44 PM.


» Today's Birthdays

Jbabycsx (38)
Love Ariel (35)

» Stats

Members: 65,813
Threads: 240,514
Posts: 2,498,807
Top Poster: JLC (31,651)
Welcome to our newest member, not_nigra
Page 1 of 2 12 LastLast
Results 1 to 10 of 13
  1. #1
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,347
    Thanks
    3,228
    Thanked 2,069 Times in 1,176 Posts

    Acid gene is looking wicked!

    The really rare, expensive new genes on the market are mostly not at value to me. The acid gene however, is so vivid, it reminds me of a freaky GHI.

    Might have to invest some serious dough to get in on this whacky artistic gene!

    https://www.morphmarket.com/us/c/rep...hons/gene/acid

  2. The Following 4 Users Say Thank You to Godzilla78 For This Useful Post:

    Bogertophis (06-14-2019),dr del (06-15-2019),J-Royals (06-21-2019),Sonny1318 (06-14-2019)

  3. #2
    BPnet Veteran Alexiel03's Avatar
    Join Date
    02-20-2010
    Location
    United States
    Posts
    830
    Thanks
    235
    Thanked 672 Times in 302 Posts
    Images: 43

    Re: Acid gene is looking wicked!

    Yeah its a pretty cool gene, they been around since 2014 but been a while since I saw anything about them lol looks like there are a few combos around now.

    Sent from my LGL164VL using Tapatalk

    Bps:
    0.1 Mojave BP (Liliana)
    0.1 Firefly BP (Chandra)
    0.1 Pastel GHI
    0.1 Pied 50% het Ghost
    0.1 Leopard Mojave
    0.1 Orange Dream Fire Yellowbelly
    0.1 Sugar Spider
    0.1 Desert Ghost
    0.1 Lesser 66% het Orange Ghost
    1.0 Fire Bee (Garruk)
    1.0 Leopard BP (Ajani)
    1.0 Butter Pastel BP (Diesel)
    1.0 Banana Pastel Enchi
    1.0 Lemon Pastel Enchi

    Non BPs:
    1.0 Sunfire Retic (Helios)R.I.P.
    1.0 Albino Burmese Python (Slayer)
    0.1 Normal het Granite Burmese Python (Pandora)
    0.2 Calico Cats (Mana and Elizabeth)
    0.1 Dog (pitbull lab mix) (Nova)

  4. The Following User Says Thank You to Alexiel03 For This Useful Post:

    J-Royals (06-21-2019)

  5. #3
    Registered User Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    9,517
    Thanks
    12,977
    Thanked 7,491 Times in 4,789 Posts
    I like the male super pastel acid (asplundii's) & the female arsenic...you should def. get them both, Godzilla78. (I'm good at spending other ppl's money...)
    Many friends in low places...

  6. The Following 2 Users Say Thank You to Bogertophis For This Useful Post:

    Godzilla78 (06-15-2019),J-Royals (06-21-2019)

  7. #4
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,347
    Thanks
    3,228
    Thanked 2,069 Times in 1,176 Posts

    Re: Acid gene is looking wicked!

    Quote Originally Posted by Bogertophis View Post
    I like the male super pastel acid (asplundii's) & the female arsenic...you should def. get them both, Godzilla78. (I'm good at spending other ppl's money...)
    If I didnít have so many upcoming bills, I would jump on that super pastel acid male!

  8. The Following 2 Users Say Thank You to Godzilla78 For This Useful Post:

    Bogertophis (06-15-2019),J-Royals (06-21-2019)

  9. #5
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,347
    Thanks
    3,228
    Thanked 2,069 Times in 1,176 Posts

    Re: Acid gene is looking wicked!

    The acid phantom lemonblast is the best, but at 5 Gs, I think I will take - few years and make my own!

  10. The Following User Says Thank You to Godzilla78 For This Useful Post:

    J-Royals (06-21-2019)

  11. #6
    Registered User Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    9,517
    Thanks
    12,977
    Thanked 7,491 Times in 4,789 Posts
    I hear ya...it's a real chunk o' change for a creature that could get sick & die out of the blue. Tempting though...
    Many friends in low places...

  12. The Following User Says Thank You to Bogertophis For This Useful Post:

    J-Royals (06-21-2019)

  13. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    800
    Thanks
    83
    Thanked 561 Times in 311 Posts

    Re: Acid gene is looking wicked!

    It is a fun gene, been enjoying playing with it in my collection

    Quote Originally Posted by Alexiel03 View Post
    been a while since I saw anything about them lol looks like there are a few combos around now.
    Josh (the originator of the morph) had some personal stuff hit him and also got totally dumped on by a bunch of people when he first brought his animals to market so he kind of went to ground, just was not interested in all the drama. But he and a few others of us have continued working the project and I expect you will see some really fun stuff from them later this season and moving forward


    Quote Originally Posted by Godzilla78 View Post
    If I didnít have so many upcoming bills...
    I do payment plans... Just saying
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. The Following User Says Thank You to asplundii For This Useful Post:

    Alexiel03 (06-17-2019)

  15. #8
    Registered User J-Royals's Avatar
    Join Date
    01-11-2015
    Location
    Orlando, FL
    Posts
    92
    Thanks
    37
    Thanked 128 Times in 56 Posts












    Josh Jensen


  16. The Following 5 Users Say Thank You to J-Royals For This Useful Post:

    asplundii (06-24-2019),Bogertophis (06-21-2019),Godzilla78 (06-21-2019),PghBall (07-08-2019),Sonny1318 (07-05-2019)

  17. #9
    Registered User J-Royals's Avatar
    Join Date
    01-11-2015
    Location
    Orlando, FL
    Posts
    92
    Thanks
    37
    Thanked 128 Times in 56 Posts
    It's been a long time since I logged in here guys and gals. Here's some of the new Acid combos of 2019, some being posted in this thread before anywhere else.
    Hope y'all enjoy.
    Josh Jensen


  18. The Following 2 Users Say Thank You to J-Royals For This Useful Post:

    asplundii (06-24-2019),Godzilla78 (06-21-2019)

  19. #10
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,347
    Thanks
    3,228
    Thanked 2,069 Times in 1,176 Posts

    Re: Acid gene is looking wicked!

    Quote Originally Posted by J-Royals View Post



    Wicked!

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1