» Site Navigation
6 members and 3,430 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,537
Posts: 2,568,716
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
BPnet Veteran
Re: Acid gene is looking wicked!
Originally Posted by J-Royals
It's been a long time since I logged in here guys and gals. Here's some of the new Acid combos of 2019, some being posted in this thread before anywhere else.
Hope y'all enjoy.
OMG Amazing!!
Are any of those mixed with Enchi?
-
-
Re: Acid gene is looking wicked!
Originally Posted by J-Royals
Oh I do love that!!!
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
-
Re: Acid gene is looking wicked!
Originally Posted by CeeJay
Are any of those mixed with Enchi?
None of those recent pics have Enchi but he did make the Acid Enchi a couple years back. And I think we will probably see more Enchi combos this season
Originally Posted by dr del
Oh I do love that!!!
Yeah, that Candino Acid is just incredible!
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
With leopard!
I think a cool gene to mix with would be with leopard and mojave. These 3 genes would be very cool
-
-
Re: With leopard!
Originally Posted by luizillo
I think a cool gene to mix with would be with leopard and mojave. These 3 genes would be very cool
Acid Mojave is a fantastic combo! The Acid really brings it to the dark side of the game.
I am still on the fence with the Acid Leopard... It makes for a darker animal, and the belly is solid black, but the overall pattern is not changed much. But I can see how the right combo of other genes could make for something crazy
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
I dont really understand how a 2 gene animal is $1000 though. Especially it being a dom and co-dom (acid YB). That's going depreciate quickly. I do understand popularity and how new a gene is but this seems outrageous to me
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|