Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 336

10 members and 326 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

None

» Stats

Members: 64,697
Threads: 239,164
Posts: 2,484,749
Top Poster: JLC (31,652)
Welcome to our newest member, Pinstripe-Toby
Results 1 to 10 of 10
  1. #1
    Registered User
    Join Date
    06-01-2019
    Posts
    5
    Thanks
    0
    Thanked 1 Time in 1 Post

    Some kind of spider morph?

    So I got this guy from someone who had no idea what genes were in him but I had to take him because he's so pretty. I know there's spider but what else is in there? Anyone have a good guess?










  2. #2
    BPnet Veteran Alexiel03's Avatar
    Join Date
    02-20-2010
    Location
    United States
    Posts
    700
    Thanks
    139
    Thanked 495 Times in 232 Posts
    Images: 43

    Re: Some kind of spider morph?

    Can't see the pics

    Sent from my LGL164VL using Tapatalk

    Bps:
    0.1 Mojave BP (Liliana)
    0.1 Firefly BP (Chandra)
    0.1 Pastel GHI
    0.1 Pied 50% het Ghost
    0.1 Leopard Mojave
    0.1 Orange Dream Fire Yellowbelly
    0.1 Sugar Spider
    0.1 Desert Ghost
    0.1 Lesser 66% het Orange Ghost
    1.0 Fire Bee (Garruk)
    1.0 Leopard BP (Ajani)
    1.0 Butter Pastel BP (Diesel)
    1.0 Banana Pastel Enchi
    1.0 Lemon Pastel Enchi

    Non BPs:
    1.0 Sunfire Retic (Helios)R.I.P.
    1.0 Albino Burmese Python (Slayer)
    0.1 Normal het Granite Burmese Python (Pandora)
    0.2 Calico Cats (Mana and Elizabeth)
    0.1 Dog (pitbull lab mix) (Nova)

  3. #3
    Telling it like it is! Deborah's Avatar
    Join Date
    09-28-2006
    Posts
    23,866
    Thanks
    5,868
    Thanked 18,972 Times in 8,866 Posts
    Blog Entries
    1
    Images: 6
    OP you cannot link an attachment from your email if you do no one can see it since no one has access to your email but you.

    If you want to add a picture either upload in your gallery or use a third party host.

  4. The Following User Says Thank You to Deborah For This Useful Post:

    dr del (06-12-2019)

  5. #4
    Registered User
    Join Date
    06-01-2019
    Posts
    5
    Thanks
    0
    Thanked 1 Time in 1 Post

    Re: Some kind of spider morph?

    Sorry, here's actual pictures




  6. #5
    BPnet Veteran Alexiel03's Avatar
    Join Date
    02-20-2010
    Location
    United States
    Posts
    700
    Thanks
    139
    Thanked 495 Times in 232 Posts
    Images: 43

    Re: Some kind of spider morph?

    He looks like hes going into shed, hard to tell but maybe he's got another gene

    Sent from my LGL164VL using Tapatalk

    Bps:
    0.1 Mojave BP (Liliana)
    0.1 Firefly BP (Chandra)
    0.1 Pastel GHI
    0.1 Pied 50% het Ghost
    0.1 Leopard Mojave
    0.1 Orange Dream Fire Yellowbelly
    0.1 Sugar Spider
    0.1 Desert Ghost
    0.1 Lesser 66% het Orange Ghost
    1.0 Fire Bee (Garruk)
    1.0 Leopard BP (Ajani)
    1.0 Butter Pastel BP (Diesel)
    1.0 Banana Pastel Enchi
    1.0 Lemon Pastel Enchi

    Non BPs:
    1.0 Sunfire Retic (Helios)R.I.P.
    1.0 Albino Burmese Python (Slayer)
    0.1 Normal het Granite Burmese Python (Pandora)
    0.2 Calico Cats (Mana and Elizabeth)
    0.1 Dog (pitbull lab mix) (Nova)

  7. #6
    Registered User
    Join Date
    10-13-2016
    Location
    VT
    Posts
    162
    Thanks
    100
    Thanked 126 Times in 65 Posts

    Re: Some kind of spider morph?

    Quote Originally Posted by Alexiel03 View Post
    He looks like hes going into shed, hard to tell but maybe he's got another gene

    Sent from my LGL164VL using Tapatalk
    Only a guess, but could it be Cinnamon or Black Pastel? Very nice, btw.

  8. #7
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,255
    Thanks
    3,131
    Thanked 1,946 Times in 1,117 Posts

    Re: Some kind of spider morph?

    Single gene spider, or slim chance some extremely subtle secondary morph.

  9. #8
    Registered User
    Join Date
    06-01-2019
    Posts
    5
    Thanks
    0
    Thanked 1 Time in 1 Post

    Re: Some kind of spider morph?

    Nope thatís just how his eyes are, plus probably a little glare from the sun and the tub. I was guessing it was more than just a spider since heís got that really vivid orange on the sides, I just donít know enough about the color genes

  10. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    767
    Thanks
    78
    Thanked 524 Times in 288 Posts
    That animal is absolutely going into a shed cycle. It is more than just they eyes that tell you this; the drab/dull nature of the colours and the pink belly are dead giveaways.

    Let it shed out and then post pics again, it will be easier to determine if there are any other morphs in there after that. Tentatively I agree with Tila on the possibility of BlkPastel or Cinny (or something else in that complex)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. #10
    BPnet Veteran Alexiel03's Avatar
    Join Date
    02-20-2010
    Location
    United States
    Posts
    700
    Thanks
    139
    Thanked 495 Times in 232 Posts
    Images: 43

    Re: Some kind of spider morph?

    Quote Originally Posted by asplundii View Post
    That animal is absolutely going into a shed cycle. It is more than just they eyes that tell you this; the drab/dull nature of the colours and the pink belly are dead giveaways.

    Let it shed out and then post pics again, it will be easier to determine if there are any other morphs in there after that. Tentatively I agree with Tila on the possibility of BlkPastel or Cinny (or something else in that complex)
    Exactly what I thought too it definitely looks like its getting ready to go into a shed cycle.
    Post pics after he sheds, it will make it a lot easier to ID properly

    Sent from my LGL164VL using Tapatalk

    Bps:
    0.1 Mojave BP (Liliana)
    0.1 Firefly BP (Chandra)
    0.1 Pastel GHI
    0.1 Pied 50% het Ghost
    0.1 Leopard Mojave
    0.1 Orange Dream Fire Yellowbelly
    0.1 Sugar Spider
    0.1 Desert Ghost
    0.1 Lesser 66% het Orange Ghost
    1.0 Fire Bee (Garruk)
    1.0 Leopard BP (Ajani)
    1.0 Butter Pastel BP (Diesel)
    1.0 Banana Pastel Enchi
    1.0 Lemon Pastel Enchi

    Non BPs:
    1.0 Sunfire Retic (Helios)R.I.P.
    1.0 Albino Burmese Python (Slayer)
    0.1 Normal het Granite Burmese Python (Pandora)
    0.2 Calico Cats (Mana and Elizabeth)
    0.1 Dog (pitbull lab mix) (Nova)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1