» Site Navigation
1 members and 2,850 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,078
Threads: 248,524
Posts: 2,568,615
Top Poster: JLC (31,651)
|
-
Registered User
-
-
Re: Some kind of spider morph?
Can't see the pics
Sent from my LGL164VL using Tapatalk
-
-
OP you cannot link an attachment from your email if you do no one can see it since no one has access to your email but you.
If you want to add a picture either upload in your gallery or use a third party host.
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
-
Registered User
-
-
Re: Some kind of spider morph?
He looks like hes going into shed, hard to tell but maybe he's got another gene
Sent from my LGL164VL using Tapatalk
-
-
Re: Some kind of spider morph?
Originally Posted by Alexiel03
He looks like hes going into shed, hard to tell but maybe he's got another gene
Sent from my LGL164VL using Tapatalk
Only a guess, but could it be Cinnamon or Black Pastel? Very nice, btw.
-
-
Re: Some kind of spider morph?
Single gene spider, or slim chance some extremely subtle secondary morph.
-
-
Registered User
Re: Some kind of spider morph?
Nope that’s just how his eyes are, plus probably a little glare from the sun and the tub. I was guessing it was more than just a spider since he’s got that really vivid orange on the sides, I just don’t know enough about the color genes
-
-
That animal is absolutely going into a shed cycle. It is more than just they eyes that tell you this; the drab/dull nature of the colours and the pink belly are dead giveaways.
Let it shed out and then post pics again, it will be easier to determine if there are any other morphs in there after that. Tentatively I agree with Tila on the possibility of BlkPastel or Cinny (or something else in that complex)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Some kind of spider morph?
Originally Posted by asplundii
That animal is absolutely going into a shed cycle. It is more than just they eyes that tell you this; the drab/dull nature of the colours and the pink belly are dead giveaways.
Let it shed out and then post pics again, it will be easier to determine if there are any other morphs in there after that. Tentatively I agree with Tila on the possibility of BlkPastel or Cinny (or something else in that complex)
Exactly what I thought too it definitely looks like its getting ready to go into a shed cycle.
Post pics after he sheds, it will make it a lot easier to ID properly
Sent from my LGL164VL using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|