Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,111

0 members and 3,111 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,535
Posts: 2,568,703
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Page 1 of 2 12 LastLast
Results 1 to 10 of 14
  1. #1
    BPnet Veteran
    Join Date
    08-06-2018
    Location
    Pennsylvania
    Posts
    300
    Thanks
    468
    Thanked 185 Times in 107 Posts

    Any planty people here?

    So one of my favorite hobbies (besides reptiles) is house plants! I've loved them for years but only really got into it a few months ago, and I got REALLY into it haha. I think I've got around 30 plants right now, give or take a few, which I guess isn't too many compared to a lot of other people in the hobby, but I really do love all the plants in my collection. I currently only have a pretty small space that's all my own and not a common space, and it's FILLED with plants, and that combined with my snake really makes it feel like a jungle and it just makes me happy haha.
    Anyway, I'm just posting this here out of curiosity to see if there are any other planty people here, maybe we could geek out about plants together

  2. The Following 4 Users Say Thank You to Ditto For This Useful Post:

    Alicia (06-11-2019),Bodie (06-11-2019),Bogertophis (06-11-2019),Sonny1318 (06-12-2019)

  3. #2
    Registered User Bodie's Avatar
    Join Date
    11-19-2018
    Location
    Goofy Florida
    Posts
    550
    Thanks
    1,543
    Thanked 481 Times in 318 Posts

    Re: Any planty people here?

    In our house, my wife is very much into the house plants. We have a little study type room that she has full of plants. She refers to it as her "zen" room. She definitively was born with a green thumb. If I were to bet on the one person that will chime in on this subject, it will be Richard. He has posted some great pics of plants and flowers that he has. I thought I read in a past thread that his job is (plant related). Sorry Richard if I was incorrect
    0.1 Emerald Tree Boa (Northern)
    0.1 Green Tree Python (Aru)
    0.1 Pueblan Milk Snake
    1.0 Mexican Black Kingsnake
    1.0 Pied Het Lavender Albino Ball Python
    1.0 Yellow Phase Eastern Hognose

  4. The Following 2 Users Say Thank You to Bodie For This Useful Post:

    Bogertophis (06-11-2019),Ditto (06-11-2019)

  5. #3
    BPnet Veteran SilentHill's Avatar
    Join Date
    02-06-2019
    Location
    Adams Co, PA
    Posts
    335
    Thanks
    104
    Thanked 454 Times in 185 Posts
    Images: 3
    i want so badly to be a "planty" person. none of my veggie gardens have worked out the last few years. tried REALLY hard this year and it seems to be a fail.
    i did get my first few houseplants about a month ago and i LOVE them. they make me happy just looking at them and they're all still alive so far. i have to be careful though b/c a lot are toxic to cats apparently....
    Gargoyle Geckos: Gorey, Gremmie, Ouija, Gojira, Bacon Bit, Penny, Wednesday
    Crested Geckos: Eggs, Triscuit, Creature & Waffles
    Leopard Geckos: Rhubarb, Pepper and Clementine
    Cal Kings: Bones & Violet
    Corn snakes: A sh*tload
    Trans-Pesos: 1.1 No names
    BPs: Charlie (super pastel), Bodhi (pied), Finn (GHI Mojave), Dublin (fire bumblebee), Falkor(mystic potion), Letty (pewter), Jameson
    BCI Boa: Specter (Fineline morph)
    SnuSnu the cat, Corbin the pit bull, Juniper the mini aussie & Lily the setter mix
    One little special needs bearded dragon P. Sherman
    Black African House Snakes: 1.1 No names
    Northern Pines: 1.1 No names
    Four skinks, one of which is named Gator & Basil the mini-lop rabbit


    'everything was beautiful and nothing hurt' - vonnegut.

    www.facebook.com/SilentHillReptiles

  6. The Following 2 Users Say Thank You to SilentHill For This Useful Post:

    Bogertophis (06-11-2019),Ditto (06-11-2019)

  7. #4
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,072 Times in 5,330 Posts
    Last year was my first year getting into plants and flowers. I haven't brought any inside though. I absolutely love how much better my yard looks with flowers around it. This year I added a flower bed on the other side of the house too. I've been slacking and have only picked out a few hanging flowers so far. This weekend I'll be picking out the rest of my annuals. My parenials are just starting to flower over the last week.
    I'm actually really enjoying it, despite always thinking it was "girly" growing up. Shows what younger me knew, hahahaha.

  8. The Following 2 Users Say Thank You to Craiga 01453 For This Useful Post:

    Bogertophis (06-11-2019),Ditto (06-11-2019)

  9. #5
    BPnet Veteran
    Join Date
    08-06-2018
    Location
    Pennsylvania
    Posts
    300
    Thanks
    468
    Thanked 185 Times in 107 Posts

    Re: Any planty people here?

    Quote Originally Posted by SilentHill View Post
    i want so badly to be a "planty" person. none of my veggie gardens have worked out the last few years. tried REALLY hard this year and it seems to be a fail.
    i did get my first few houseplants about a month ago and i LOVE them. they make me happy just looking at them and they're all still alive so far. i have to be careful though b/c a lot are toxic to cats apparently....
    I've never had any luck with outdoor plants, I feel your pain lol. I'm so thankful my cats have no interest in my plants. I've heard that lillies are some of the most toxic, that's probably wrong and I'm not sure where I even heard it from, but I stay away from them just in case haha

  10. #6
    BPnet Veteran
    Join Date
    08-06-2018
    Location
    Pennsylvania
    Posts
    300
    Thanks
    468
    Thanked 185 Times in 107 Posts

    Re: Any planty people here?

    Quote Originally Posted by Craiga 01453 View Post
    Last year was my first year getting into plants and flowers. I haven't brought any inside though. I absolutely love how much better my yard looks with flowers around it. This year I added a flower bed on the other side of the house too. I've been slacking and have only picked out a few hanging flowers so far. This weekend I'll be picking out the rest of my annuals. My parenials are just starting to flower over the last week.
    I'm actually really enjoying it, despite always thinking it was "girly" growing up. Shows what younger me knew, hahahaha.
    Good for you!! I wish I was any good with outdoor plants, but I've just never been able to get it right If you've never tried having house plants I'd really recommend it, really easy to get addicted though.. kinda like snakes but cheaper haha
    Last edited by Ditto; 06-11-2019 at 06:41 PM.

  11. The Following User Says Thank You to Ditto For This Useful Post:

    Craiga 01453 (06-12-2019)

  12. #7
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,247
    Thanks
    28,161
    Thanked 19,825 Times in 11,844 Posts
    I'm mostly into my yard plants these days...I grow tomatoes (LOTS of them) & especially enjoy all that blooms & keeps the bees happy here; I'm pretty busy so I
    especially appreciate all the flowers that reappear on their own every year...daffodils, flowering redbud trees, azaleas, irises, mimosa tree, daylillies, crepe myrtles,
    purple vincas, holly & other shrubs with red berries, and all the other stuff out here...walking thru my yard (especially the back yard) it's my own private park, with
    many huge shade trees too. It just makes me feel good to be out there. As common as many of my flowers are, like the 8 large groupings of orange daylillies
    blooming right now (both front & back), they really brighten the day with tropical color...I can't help but be in a better mood when I stroll the path among them.
    I'm a "recycler"/rescuer type, so it pleases me that most of my irises & daylillies were thinned & unwanted where they were previously, & "free to any home".
    They've repaid me handsomely for taking them in.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  13. The Following User Says Thank You to Bogertophis For This Useful Post:

    Ditto (06-12-2019)

  14. #8
    BPnet Senior Member richardhind1972's Avatar
    Join Date
    12-31-2017
    Location
    derbyshire, uk
    Posts
    4,646
    Thanks
    10,964
    Thanked 7,173 Times in 3,204 Posts

    Re: Any planty people here?

    I'm into my plants and actually been doing horticulture in the uk both landscaping and garden centres since leaving school 30yrs ago, I love them and I used to have to go to Holland buying houseplants every 3 weeks wich was a lot of fun and Italy in the spring buying specimen shrubs for 3 days a time
    Worse luck the owner sold the land to a developer to build houses on

    I still buy houseplants for my centre I'm at now and get to make some great displays with them, but I gues alot of our houseplants in the uk are actually your outdoor plants in the states depending on where you live

    Sent from my CLT-L09 using Tapatalk

  15. The Following 2 Users Say Thank You to richardhind1972 For This Useful Post:

    Bogertophis (06-12-2019),Ditto (06-12-2019)

  16. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I have grown carnivorous plants for over two decades. Back when I lived in Atlanta I had a collection of over 500 species/forms. Now I mostly grow just Sarracenia in a bog garden that has a few Drosera scattered about as "weeds"

    I dinker around with other things. I always enjoyed "grocery store" planting, in the past I have grown pineapples, avocado, mango, oranges, sugarcane... I am trying mamey and jackfruit now
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  17. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (06-12-2019),Craiga 01453 (06-12-2019),Ditto (06-12-2019)

  18. #10
    BPnet Veteran
    Join Date
    08-06-2018
    Location
    Pennsylvania
    Posts
    300
    Thanks
    468
    Thanked 185 Times in 107 Posts

    Re: Any planty people here?

    Quote Originally Posted by asplundii View Post
    I have grown carnivorous plants for over two decades. Back when I lived in Atlanta I had a collection of over 500 species/forms. Now I mostly grow just Sarracenia in a bog garden that has a few Drosera scattered about as "weeds"

    I dinker around with other things. I always enjoyed "grocery store" planting, in the past I have grown pineapples, avocado, mango, oranges, sugarcane... I am trying mamey and jackfruit now
    Wow that's awesome! I've never tried owning any carnivorous plants before but I've admired them from afar since I was a kid, always been a little too scared of killing them to actually buy one, though, haha

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1