Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,005

9 members and 996 guests
Most users ever online was 4,261, 10-01-2019 at 06:44 PM.


» Today's Birthdays

None

» Stats

Members: 65,838
Threads: 240,528
Posts: 2,498,997
Top Poster: JLC (31,651)
Welcome to our newest member, JaguarFan
Results 1 to 9 of 9
  1. #1
    Registered User SilentHill's Avatar
    Join Date
    02-06-2019
    Location
    Adams Co, PA
    Posts
    254
    Thanks
    60
    Thanked 307 Times in 132 Posts
    Images: 3

    Colubrid Con...?

    wondering if anyone would be interested in a colubrid/snake nerd gathering in the northeast, much like carpet fest if you are familiar.
    basically an annual bbq with camping and shenanigans. we could host on our little farm in PA.

    Sent from my SM-G950U using Tapatalk
    Gargoyle Geckos: Gorey, Gremmie, Ouija, Gojira, Bacon Bit, Pork Chop, Penny, Wednesday & hatchlings Saturday and Sunday
    Crested Geckos: Eggs, Uno, Triscuit, Creature & Waffles
    Leopard Geckos: Rhubarb, Pepper and No-Name
    Cal Kings: Bones & Violet
    Corn snakes: Moonshine (anery tessera), Zorg (anery), Clarice (honey) & Mouse (normal)
    BPs: Charlie (super pastel), Bodhi (pied), Finn (GHI Mojave), Dublin (fire bumblebee), Falkor(mystic potion), Letty (pewter)
    BCI Boa: Specter (Fineline morph), Sunglow and/or Snow coming soon....
    SnuSnu the cat, Corbin the pit bull, Cinna the collie mix & Lily the setter mix, Tofu the axolotl
    Pixie the barn cat plus one little special needs bearded dragon P. Sherman

    'everything was beautiful and nothing hurt' - vonnegut.

    www.facebook.com/SilentHillReptiles

  2. The Following 2 Users Say Thank You to SilentHill For This Useful Post:

    Bogertophis (06-13-2019),Reinz (06-11-2019)

  3. #2
    BPnet Veteran Craiga 01453's Avatar
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    8,945
    Thanks
    11,394
    Thanked 8,216 Times in 4,199 Posts
    I think that's a super cool idea!!

    I've driven to PA a few times in the past for hockey tournaments, it's not too bad a haul.

    I'd have to count myself out for this year though. I've got shoulder surgery coming up in a few weeks. That's gonna derail my summer fun into fall.

    But if I have a few months notice I might be down for the next one.
    ...life is beautiful...

    0.1 Bredli Python - Fernie
    1.0 Vanilla het Pied BP - Tyson
    1.0 Pastel Fader BP - Dembe
    1.0 California Kingsnake - Django
    1.0 Western Hognose - Cosmo
    1.0 Borneo Short Tail Python - Juice
    1.0 Anery Kenyan Sando Boa - Willow
    2.2 Ferrets - Baloo, Johnny & June and Chloe
    0.2 Cats - Simba & Nala

  4. The Following User Says Thank You to Craiga 01453 For This Useful Post:

    SilentHill (06-11-2019)

  5. #3
    BPnet Senior Member Reinz's Avatar
    Join Date
    08-05-2013
    Location
    East TX
    Posts
    7,715
    Thanks
    4,641
    Thanked 4,178 Times in 2,888 Posts
    Images: 9
    That is a great idea and quite generous of you. I sure hope it takes root and is a wonderful success.
    The one thing I found that you can count on about Balls is that they are consistent about their inconsistentcy.

    1.2 Coastal Carpet Pythons
    Mack The Knife, 2013
    Lizzy, 2010
    Etta, 2013
    1.1 Jungle Carpet Pythons
    Esmarelda , 2014
    Sundance, 2012
    2.0 Common BI Boas, Punch, 2005; Butch, age?
    0.1 Normal Ball Python, Elvira, 2001
    0.1 Olive (Aussie) Python, Olivia, 2017

    Please excuse the spelling in my posts. Auto-Correct is my worst enema.

  6. #4
    Registered User SilentHill's Avatar
    Join Date
    02-06-2019
    Location
    Adams Co, PA
    Posts
    254
    Thanks
    60
    Thanked 307 Times in 132 Posts
    Images: 3
    i have started a FB group if anyone would like to join:

    https://www.facebook.com/groups/347572955953325/
    Gargoyle Geckos: Gorey, Gremmie, Ouija, Gojira, Bacon Bit, Pork Chop, Penny, Wednesday & hatchlings Saturday and Sunday
    Crested Geckos: Eggs, Uno, Triscuit, Creature & Waffles
    Leopard Geckos: Rhubarb, Pepper and No-Name
    Cal Kings: Bones & Violet
    Corn snakes: Moonshine (anery tessera), Zorg (anery), Clarice (honey) & Mouse (normal)
    BPs: Charlie (super pastel), Bodhi (pied), Finn (GHI Mojave), Dublin (fire bumblebee), Falkor(mystic potion), Letty (pewter)
    BCI Boa: Specter (Fineline morph), Sunglow and/or Snow coming soon....
    SnuSnu the cat, Corbin the pit bull, Cinna the collie mix & Lily the setter mix, Tofu the axolotl
    Pixie the barn cat plus one little special needs bearded dragon P. Sherman

    'everything was beautiful and nothing hurt' - vonnegut.

    www.facebook.com/SilentHillReptiles

  7. #5
    BPnet Senior Member dakski's Avatar
    Join Date
    02-07-2014
    Location
    Connecticut
    Posts
    2,721
    Thanks
    3,711
    Thanked 4,327 Times in 2,031 Posts
    Blog Entries
    1
    Images: 134

    Re: Colubrid Con...?

    Quote Originally Posted by SilentHill View Post
    i have started a FB group if anyone would like to join:

    https://www.facebook.com/groups/347572955953325/
    I donít have FB but please keep me in the loop.

  8. #6
    Registered User SilentHill's Avatar
    Join Date
    02-06-2019
    Location
    Adams Co, PA
    Posts
    254
    Thanks
    60
    Thanked 307 Times in 132 Posts
    Images: 3

    Re: Colubrid Con...?

    yes, i will keep everyone posted. one of the hosts doesn't have FB either lol
    Gargoyle Geckos: Gorey, Gremmie, Ouija, Gojira, Bacon Bit, Pork Chop, Penny, Wednesday & hatchlings Saturday and Sunday
    Crested Geckos: Eggs, Uno, Triscuit, Creature & Waffles
    Leopard Geckos: Rhubarb, Pepper and No-Name
    Cal Kings: Bones & Violet
    Corn snakes: Moonshine (anery tessera), Zorg (anery), Clarice (honey) & Mouse (normal)
    BPs: Charlie (super pastel), Bodhi (pied), Finn (GHI Mojave), Dublin (fire bumblebee), Falkor(mystic potion), Letty (pewter)
    BCI Boa: Specter (Fineline morph), Sunglow and/or Snow coming soon....
    SnuSnu the cat, Corbin the pit bull, Cinna the collie mix & Lily the setter mix, Tofu the axolotl
    Pixie the barn cat plus one little special needs bearded dragon P. Sherman

    'everything was beautiful and nothing hurt' - vonnegut.

    www.facebook.com/SilentHillReptiles

  9. #7
    BPnet Veteran Craiga 01453's Avatar
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    8,945
    Thanks
    11,394
    Thanked 8,216 Times in 4,199 Posts

    Re: Colubrid Con...?

    Quote Originally Posted by SilentHill View Post
    yes, i will keep everyone posted. one of the hosts doesn't have FB either lol
    No FB for me either. But I'll be keeping an eye on this thread and hoping you have a great time and I can make the 2nd annual event
    ...life is beautiful...

    0.1 Bredli Python - Fernie
    1.0 Vanilla het Pied BP - Tyson
    1.0 Pastel Fader BP - Dembe
    1.0 California Kingsnake - Django
    1.0 Western Hognose - Cosmo
    1.0 Borneo Short Tail Python - Juice
    1.0 Anery Kenyan Sando Boa - Willow
    2.2 Ferrets - Baloo, Johnny & June and Chloe
    0.2 Cats - Simba & Nala

  10. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    800
    Thanks
    83
    Thanked 561 Times in 311 Posts
    Not knocking the idea because I think people getting out from behind their keyboards is a great idea but I do want to say that CarpetFest is NOT exclusive to carpet keepers, it is open to any and all reptile enthusiasts. So you should absolutely feel free to attend it as well . I have been to three of the last four (missed one because I was moving) and I do not own a single carpet.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following User Says Thank You to asplundii For This Useful Post:

    SilentHill (06-30-2019)

  12. #9
    BPnet Veteran Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,278
    Thanks
    598
    Thanked 1,382 Times in 616 Posts

    Re: Colubrid Con...?

    That sounds like a nice idea. My parents are in Gettysburg and I could potentially plan a coinciding visit though It's unlikely I could if it's in October. I vend a Pittsburgh show the first weekend, Tinley the second, Hamburg is the 3rd weekend, then my brothers Halloween wedding. Hopefully you can get a nice group for your generous offer either way!

    Sent from my Pixel 3 using Tapatalk

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1