Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,124

11 members and 1,113 guests
Most users ever online was 4,261, 10-01-2019 at 06:44 PM.


» Today's Birthdays

» Stats

Members: 65,844
Threads: 240,579
Posts: 2,499,533
Top Poster: JLC (31,651)
Welcome to our newest member, jaymims
Results 1 to 2 of 2
  1. #1
    Registered User SilentHill's Avatar
    Join Date
    02-06-2019
    Location
    Adams Co, PA
    Posts
    256
    Thanks
    61
    Thanked 307 Times in 132 Posts
    Images: 3

    baltimore md Repticon

    ...this weekend! anyone attending? we will be there both days.

    Sent from my SM-G950U using Tapatalk
    Gargoyle Geckos: Gorey, Gremmie, Ouija, Gojira, Bacon Bit, Pork Chop, Penny, Wednesday & hatchlings Saturday and Sunday
    Crested Geckos: Eggs, Uno, Triscuit, Creature & Waffles
    Leopard Geckos: Rhubarb, Pepper and No-Name
    Cal Kings: Bones & Violet
    Corn snakes: Moonshine (anery tessera), Zorg (anery), Clarice (honey) & Mouse (normal)
    BPs: Charlie (super pastel), Bodhi (pied), Finn (GHI Mojave), Dublin (fire bumblebee), Falkor(mystic potion), Letty (pewter)
    BCI Boa: Specter (Fineline morph), Sunglow and/or Snow coming soon....
    SnuSnu the cat, Corbin the pit bull, Cinna the collie mix & Lily the setter mix, Tofu the axolotl
    Pixie the barn cat plus one little special needs bearded dragon P. Sherman

    'everything was beautiful and nothing hurt' - vonnegut.

    www.facebook.com/SilentHillReptiles

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    801
    Thanks
    83
    Thanked 561 Times in 311 Posts
    I will be there Sunday, picking up a rack (or two)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    SilentHill (05-23-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1