» Site Navigation
1 members and 3,180 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,079
Threads: 248,524
Posts: 2,568,619
Top Poster: JLC (31,651)
|
-
Registered User
Re: A Mystery Snake
Originally Posted by mdb730
My enchi het clown looks exactly like yours, she came from a lazik line clown and I have a friend who has a het clown who is also very very bright. Sometimes the het influences the look of the snake.
Interesting! I've been scouring the internet trying to find another Enchi that looks like her, with no luck. Would you be willing to post a photo of yours? I'd love to see her.
- Charles Eye
-
-
Re: A Mystery Snake
Originally Posted by Eye4Pythons
In other words, androgenesis results in super forms and since she only has one apparent super form, she only has that morph (if she is, in fact, a product of androgenesis). That's what I got from what you said, anyway. Is that about right or has my simplification overlooked something important?
Sorry, looking back I did go a little "science lecture mode" there LOL. But yes, that is pretty much the punchline to it.
Originally Posted by Eye4Pythons
This is really fascinating. I wish I would have realized as much in my formative years. Oh well. Never too late to learn something new!
A good policy to live by. I try to pick up something new every day, which is why I have a massive file of scientific articles taking up an enormous amount of file space on my computer LOL
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
Re: A Mystery Snake
That's quite alright. I'd rather see the more complicated answer, so I have more than just the "meat and potatoes" of it. Thanks for your help.
-
The Following User Says Thank You to Eye4Pythons For This Useful Post:
-
BPnet Veteran
Re: A Mystery Snake
Mind what breeder I ask where she came from ?
Sent from my Moto Z2 Play using Tapatalk
-
-
Registered User
Re: A Mystery Snake
Originally Posted by stoaob3
Mind what breeder I ask where she came from ?
Sent from my Moto Z2 Play using Tapatalk
Milbradt & Caponetto Pythons.
- Charles Eye
-
-
BPnet Veteran
Re: A Mystery Snake
Its head looks like my super Enchi yellow belly. Not saying that's what it is. Just looks similar except mines perfectly symmetrical. I have scene an Enchi like this when I was working at Garricks and was also het clown .... I'm willing to bet it had more than what it was Identified as
Sent from my Moto Z2 Play using Tapatalk
-
The Following User Says Thank You to stoaob3 For This Useful Post:
-
BPnet Veteran
Re: A Mystery Snake
Originally Posted by Eye4Pythons
I recently purchased a new female to add to my extremely modest collection. She was advertised as an Enchi 100% het Clown. She looks like a Super Enchi to me (and to her breeder).
Her parents are 1.0 OD Enchi het Clown and 0.1 visual Clown. I've talked to a few people about her and have been told she could be an Enchi Blade het Clown (meaning the breeder may not know he has some Blade in his collection). This seems like a perfectly reasonable explanation and I do plan to prove her out eventually but I thought I'd ask the rest of you what you thought, in the meantime.
Whether she's got an extra gene or she's just the coolest looking Enchi I've ever seen, I'm very happy with her. I mean, look at her. She's gorgeous!
Sent from my Moto G Play using Tapatalk
Could be a super blade Enchi
Sent from my Moto Z2 Play using Tapatalk
-
The Following User Says Thank You to stoaob3 For This Useful Post:
-
Registered User
Re: A Mystery Snake
Originally Posted by stoaob3
Could be a super blade Enchi
Sent from my Moto Z2 Play using Tapatalk
That would be fine by me. I've always been a fan of bonus features.
- Charles Eye
-
-
BPnet Veteran
Re: A Mystery Snake
Can't go wrong with extra genes that weren't in the price BONUS
Sent from my Moto Z2 Play using Tapatalk
-
The Following User Says Thank You to stoaob3 For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|