Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,298

1 members and 3,297 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,533
Posts: 2,568,700
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Page 2 of 2 FirstFirst 12
Results 11 to 13 of 13
  1. #11
    Registered User Jcd5v's Avatar
    Join Date
    02-04-2019
    Posts
    159
    Thanks
    65
    Thanked 93 Times in 42 Posts

    Re: What is it like to own a BEL?

    Quote Originally Posted by Kamr View Post
    Thanks everyone for the replies ! Is it harder to keep them clean ? I'm going to be using Cypress mulch in her tub . Everything is set up and I'm currently letting it run for a few days (6) to make sure it heats well before she arrives. She will be at the bottom of the rack. Not sure how many quarts her tub is but I was told it could fit a full grown male. My biggest ball is 402g so I haven't experienced an adult being in the tub yet. They all have room to move around. Really excited to have my first all white ball python and I appreciate the help from you guys.

    Was also wondering if the pink hue while going into shed will stay when she's an adult? She's 237g as of yesterday. Breeder said she shed a few weeks ago so I should expect her to shed soon. I can see where the pink belly will be easier to spot on her since she is white, not sure why I didn't think of that as it is how I can tell on my other bps. Think I was thinking more along the lines of the eyes being a lighter blue shade.
    Mine doesn’t get any dirtier than my others. Mine also has a pink hue to him all the time which makes the pink belly kind of a null point with him.


    Sent from my iPhone using Tapatalk
    BS in Animal Science- Future Exotic Veterinarian
    1.0 X Karma BEL- Apollo
    1.0 X Mystic x Ghost- Kronos
    0.1 X Invisiball Spider- Medusa

  2. The Following User Says Thank You to Jcd5v For This Useful Post:

    Kamr (03-20-2019)

  3. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What is it like to own a BEL?

    Quote Originally Posted by Kamr View Post
    Is it harder to keep them clean ?
    Let me just put it this way... When your normal coloured ball python leaves you a brown mess to clean up you probably will not notice if he crawls through it before you get to cleaning. With a BluEL (or BlkEL or Ivory or Albino) you will most certainly notice who crawled through it LOL


    Quote Originally Posted by Kamr View Post
    Was also wondering if the pink hue while going into shed will stay when she's an adult?
    I have white snakes ranging up to 2000g and they all get pink before a shed.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Dianne (03-19-2019),Kamr (03-20-2019)

  5. #13
    BPnet Veteran hilabeans's Avatar
    Join Date
    09-26-2017
    Location
    Texas
    Posts
    992
    Thanks
    1,253
    Thanked 1,252 Times in 617 Posts
    Images: 7
    Just to pile on...

    It's very easy to tell when my guy is going into shed by the rosy-pink hue he sports and the cloudy eyes. Boom, one week later a nice, new pearly white snake. I use Reptile Prime bedding and it never leaves him "dirty". Only if he crawls thru water and then thru his substrate, but honestly I don't think you're going to pay much attention. It just brushes off. I don't know if mine is just a neat-freak or what, but he's never crawled thru his poop. Then again I spot clean daily, so he doesn't have much chance to revisit it.

    BELs are beautiful snakes. Sometimes I just stare endlessly at him and marvel. You're going to love having one!

    1.0 Lesser Mojave Ball Python "Neptune"; 1.0 Western Hognose "Murray"

    Lizards:
    1.0 Bearded Dragon "Nigel"

    Tarantulas:
    0.1 G. Rosea "Charlotte"; 0.1 B. Albopilosum "Matilda"; 0.1 C. Versicolor "Bijou"; 1.0 B. Boehmei "Lightening McQueen"

    Inverts:
    1.0 Emperor Scorpion "Boba"

    Dog & Cats:

    1.0 Doberman Pinscher "Bulleit"; 1.0 Siamese Cat "Boudreaux"; 1.0 British Shorthair Cat "Oliver”


    Goats:
    "Hazelnut" & "Huckleberry"


  6. The Following 2 Users Say Thank You to hilabeans For This Useful Post:

    Dianne (03-19-2019),Kamr (03-20-2019)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1