» Site Navigation
2 members and 2,730 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,079
Threads: 248,524
Posts: 2,568,623
Top Poster: JLC (31,651)
|
-
"See" you on the other side! (and I'm not a "sir" )
-
The Following User Says Thank You to Bogertophis For This Useful Post:
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by Bogertophis
"See" you on the other side! (and I'm not a "sir" )
My apologies. I honestly had no clue. No offense intended!
-
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by pbenner
My apologies. I honestly had no clue. No offense intended!
I know & none taken ...it's just that so many here seem to think I'm a guy that I'm considering a sex-change...
-
The Following User Says Thank You to Bogertophis For This Useful Post:
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by Bogertophis
I know & none taken ...it's just that so many here seem to think I'm a guy that I'm considering a sex-change...
Isn't that called an addadictome?
-
The Following 4 Users Say Thank You to pbenner For This Useful Post:
Alter-Echo (03-17-2019),Bogertophis (03-17-2019),Dianne (03-17-2019),RoyalLover (04-01-2019)
-
Re: A Breeder jumped down my throat at Tinley...
I think we should be able to add 1.0 or 0.1 after our names to reduce confusion.
Other Snakes:
Hudson 1988 1.0 Colombian rainbow; Yang 2002 1.0 Corn snake; Merlin 2000 1.0 Solomon Island ground boa; Kett 2015 1.0 Diamond Jungle Jaguar carpet python; Dakota 2014 0.0.1 Children’s python
Ball pythons:
Eli 1990 1.0 Normal; Buttercup 2015 1.0 Albino; Artemis 2015 0.1 Dragonfly; Orion 2015 1.0 Banana Pinstripe; Button 2018 1.0 Blue Eyed Lucy; Piper 2018 0.1 Piebald; Belle 2018 0.1 Lemonblast; Sabrina 2017 0.1 Mojave; Selene 2017 0.1 Banana Mojave; Loki 2018 1.0 Pastel Mystic Potion; Cuervo 2018 1.0 Banana Piebald; Claude 2017 1.0 Albino Pastel Spider; Penelope 2016 0.1 Lesser
-
The Following 6 Users Say Thank You to Dianne For This Useful Post:
AbsoluteApril (03-18-2019),Alicia (03-18-2019),Alter-Echo (03-17-2019),Bogertophis (03-17-2019),JRLongton (03-18-2019),RoyalLover (04-01-2019)
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by Dianne
I think we should be able to add 1.0 or 0.1 after our names to reduce confusion.
That's a great idea!
-
-
Registered User
Re: A Breeder jumped down my throat at Tinley...
Maybe i shouldn't say this but based on what I've seen from the reptitubers a lot of partying and such goes on at tinley. You may have dealt with a guy that was not entirely in his right mind and caused him to act differently than he normally would have. Just a thought
Either way you acted fine and you weren't wrong so all is well! I wouldn't buy from anyone like that either.
Sent from my SM-N960U using Tapatalk
-
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by pbenner
If he is right, then I have been ignorant for too long, and if he's wrong, I need to know I am right.
Fairly certain I know who you are talking about and while I am not defending his behaviour I will just say that is his personality. Assuming it was who I think then I am guessing he quite likely butchered any explanation he has heard in the past, most of which he got from me (guessing my name may have been one of those he tossed out as well), again, because that is his personality.
To answer your question about co-dom... Give this a listen, it should help you
http://www.blogtalkradio.com/morelia...tic-roundtable
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Bogertophis (03-18-2019),pbenner (03-18-2019)
-
A Breeder jumped down my throat at Tinley...
The correct term is incomplete dominant. But co-dominant was used for a very long time by many breeders and hobbyists to refer to morphs that followed that method of gene expression, and everyone knows that, so why he randomly decides to jump down your throat..... who knows.
Also, “visual recessive” may be the way he LIKES to think about it - but that’s not an actual thing, as far as I’m aware (but I’m no geneticist). By definition, a recessive gene is not visually expressed in heterozygous individuals. That is what makes something dominant - the fact that it affects the phenotype when only one copy of the gene is present.
So you were both wrong again, as far as I can surmise.
Sent from my iPhone using Tapatalk
Last edited by alittleFREE; 03-18-2019 at 09:11 AM.
- Summer
0.1 Bearded Dragon ("Reka")
0.1 California Kingsnake ("Cleo")
0.1 Cinnamon Spider Het. Albino Ball Python ("Syd")
1.0 Hypo Bredl’s Python (“Oz”)
-
The Following 2 Users Say Thank You to alittleFREE For This Useful Post:
Alicia (03-18-2019),WhompingWillow (03-18-2019)
-
Re: A Breeder jumped down my throat at Tinley...
Originally Posted by asplundii
Fairly certain I know who you are talking about and while I am not defending his behaviour I will just say that is his personality. Assuming it was who I think then I am guessing he quite likely butchered any explanation he has heard in the past, most of which he got from me (guessing my name may have been one of those he tossed out as well), again, because that is his personality.
To answer your question about co-dom... Give this a listen, it should help you
http://www.blogtalkradio.com/morelia...tic-roundtable
I listened to this on the start of my ride down to Texas. Exactly what I was looking for. Thank you so much.
Paul
-
The Following User Says Thank You to pbenner For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|