Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 677

4 members and 673 guests
Most users ever online was 6,337, 01-24-2020 at 03:30 AM.

» Today's Birthdays

None

» Stats

Members: 71,327
Threads: 245,378
Posts: 2,543,676
Top Poster: JLC (31,651)
Welcome to our newest member, Chipper
Results 1 to 2 of 2
  1. #1
    Registered User
    Join Date
    09-04-2008
    Posts
    72
    Thanks
    2
    Thanked 9 Times in 8 Posts

    Price Check: Anyone seen Red Stripe Het Pieds?

    Hi all. Was looking for opinions on current price of Red Stripe Het Pieds. None listed on morphmarket right now and haven't seen them posted anywhere.

    Thanks in advance.

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    892
    Thanks
    97
    Thanked 683 Times in 367 Posts
    JKR has had them in the past I believe... Not sure if his ever ended up on MM but I believe I recall seeing them on his breeding pages at some point
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1