Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 894

16 members and 878 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 65,253
Threads: 239,925
Posts: 2,492,606
Top Poster: JLC (31,652)
Welcome to our newest member, Danaday
Page 1 of 2 12 LastLast
Results 1 to 10 of 13
  1. #1
    Registered User
    Join Date
    03-02-2019
    Location
    Illinois
    Posts
    22
    Thanks
    10
    Thanked 6 Times in 5 Posts

    ProHeat Radiant Heat Panel Questions?

    So I have messaged Bob and I'm waiting for a response but I am just curious if any past customers could tell me the price they paid for their panel? I know they very so much but I am just curious to get a very general price range for reference.

  2. #2
    BPnet Veteran jmcrook's Avatar
    Join Date
    04-05-2016
    Location
    Mississippi
    Posts
    1,965
    Thanks
    4,118
    Thanked 2,547 Times in 1,213 Posts
    Images: 13

    Re: ProHeat Radiant Heat Panel Questions?

    My Pro Heat panels are 65watt-~$100(4x2x1 cages), 125watt-$150(6x2.5x1.5 cage), and 190watt-$275(8x2.5x2 cage).
    These prices I believe were including shipping as well. The 190watt was definitely shipping included I know as itís my most recent RHP purchase


    Sent from my iPhone using Tapatalk

  3. The Following 2 Users Say Thank You to jmcrook For This Useful Post:

    BurntFrosting (03-03-2019),Reinz (03-03-2019)

  4. #3
    Registered User
    Join Date
    03-02-2019
    Location
    Illinois
    Posts
    22
    Thanks
    10
    Thanked 6 Times in 5 Posts

    Re: ProHeat Radiant Heat Panel Questions?

    Quote Originally Posted by jmcrook View Post
    My Pro Heat panels are 65watt-~$100(4x2x1 cages), 125watt-$150(6x2.5x1.5 cage), and 190watt-$275(8x2.5x2 cage).
    These prices I believe were including shipping as well. The 190watt was definitely shipping included I know as itís my most recent RHP purchase


    Sent from my iPhone using Tapatalk
    Oh thank you so much! I'm getting a 72L x 30W x 18H so I am betting on the $150 option then. That is super helpful, thanks again!

  5. #4
    BPnet Senior Member Reinz's Avatar
    Join Date
    08-05-2013
    Location
    East TX
    Posts
    7,630
    Thanks
    4,552
    Thanked 4,126 Times in 2,857 Posts
    Images: 9
    Iím thinking my Proproducts were around $150 for my T-25s as well. But it can vary depending upon were you live and how you keep your climate control.
    The one thing I found that you can count on about Balls is that they are consistent about their inconsistentcy.

    1.2 Coastal Carpet Pythons
    Mack The Knife, 2013
    Lizzy, 2010
    Etta, 2013
    1.1 Jungle Carpet Pythons
    Esmarelda , 2014
    Sundance, 2012
    2.0 Common BI Boas, Punch, 2005; Butch, age?
    0.1 Normal Ball Python, Elvira, 2001
    0.1 Olive (Aussie) Python, Olivia, 2017

    Please excuse the spelling in my posts. Auto-Correct is my worst enema.

  6. #5
    Registered User scarThePiedBall's Avatar
    Join Date
    12-28-2018
    Location
    GA
    Posts
    60
    Thanks
    28
    Thanked 53 Times in 28 Posts
    Images: 14
    Definitely make sure you call or email to talk over your enclosure and conditions it will be in. They leave no stone un turned trying to figure out the best panel for you. I just ordered a PH-3 75w for my T10 (48x24x15) and was $121.90 shipped
    0.0.1 Paradox Pied BP

  7. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    791
    Thanks
    80
    Thanked 550 Times in 304 Posts
    Wish I could tell you but I have emailed then four separate times and never once received a reply so I am rapidly approaching the point of scratching them off my list as an option
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #7
    Registered User Bodie's Avatar
    Join Date
    11-19-2018
    Location
    Goofy Florida
    Posts
    361
    Thanks
    621
    Thanked 277 Times in 190 Posts

    Re: ProHeat Radiant Heat Panel Questions?

    Best bet is to call them. Bob is great to talk to and very helpful. I have ordered a total of six panels from three different occasions. I got two 40 watt, two 60 watt and was suppose to get another two 60 watts but some parts were going to take a lot longer than he originally told me so he upgraded me and let me have two 75 watts for the price of the 60s. He is a good guy
    0.1 Emerald Tree Boa (Northern) "Ozzie"
    0.1 Green Tree Python (Aru) "Sassy"
    0.1 Pueblan Milk Snake "Milkshake"
    1.0 Mexican Black Kingsnake "Sooty"
    1.0 Pied Het Lavender Albino Ball Python "Socket"
    1.0 Yellow Phase Eastern Hognose "Piggy Smalls"

  9. #8
    Registered User
    Join Date
    03-02-2019
    Location
    Illinois
    Posts
    22
    Thanks
    10
    Thanked 6 Times in 5 Posts

    Re: ProHeat Radiant Heat Panel Questions?

    Yep! He got back to me this morning and itís going to be $150 +$20 shipping so not bad. I just like the idea of having the reliable heat souce for my boa.

  10. #9
    Registered User
    Join Date
    03-02-2019
    Location
    Illinois
    Posts
    22
    Thanks
    10
    Thanked 6 Times in 5 Posts

    Re: ProHeat Radiant Heat Panel Questions?

    Quote Originally Posted by asplundii View Post
    Wish I could tell you but I have emailed then four separate times and never once received a reply so I am rapidly approaching the point of scratching them off my list as an option
    Really? I got my reply within 2 days. Huh...

  11. #10
    BPnet Veteran CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,617
    Thanks
    2,936
    Thanked 2,213 Times in 1,260 Posts
    Images: 23

    ProHeat Radiant Heat Panel Questions?

    Quote Originally Posted by BurntFrosting View Post
    Oh thank you so much! I'm getting a 72L x 30W x 18H so I am betting on the $150 option then. That is super helpful, thanks again!
    Go with the 150 watt.. your better off having more than you need than not enough.
    All the prices listed from the Boyz are correct. This year also he has changed to a 15 year warranty. My 150 watt was $198 total.
    The only thing im not happy with is that he took the Red Light off them. I loved that as it told me it was working without having to feel it.. of course if my enclosure gets cool the Herpstat alarm goes off.. but I still liked the light.
    PS- call BOB. He isnít always getting emails on his phone right away..


    Sent from my iPhone using Tapatalk
    Last edited by CALM Pythons; 03-04-2019 at 12:14 PM.
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1