Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 323

9 members and 314 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 63,730
Threads: 237,646
Posts: 2,468,289
Top Poster: JLC (31,652)
Welcome to our newest member, JDF
Results 1 to 5 of 5
  1. #1
    Registered User
    Join Date
    03-18-2018
    Posts
    4
    Thanks
    7
    Thanked 1 Time in 1 Post

    Exclamation Can reptiles get the flu

    I have influenza A and Iím worried that itís contagious to my reptiles. Anyone know if reptiles can get the flu?

  2. #2
    Registered User Jcd5v's Avatar
    Join Date
    02-04-2019
    Posts
    141
    Thanks
    56
    Thanked 78 Times in 36 Posts

    Re: Can reptiles get the flu

    No it canít.


    Sent from my iPhone using Tapatalk
    BS in Animal Science- Future Exotic Veterinarian
    1.0 X Karma BEL- Apollo
    1.0 X Mystic x Ghost- Kronos
    0.1 X Invisiball Spider- Medusa

  3. The Following User Says Thank You to Jcd5v For This Useful Post:

    Bogertophis (03-01-2019)

  4. #3
    Telling it like it is! Deborah's Avatar
    Join Date
    09-28-2006
    Posts
    23,538
    Thanks
    5,785
    Thanked 18,264 Times in 8,612 Posts
    Blog Entries
    1
    Images: 6
    Nope (species specific)

  5. The Following User Says Thank You to Deborah For This Useful Post:

    Sonny1318 (02-28-2019)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    732
    Thanks
    73
    Thanked 487 Times in 269 Posts

    Re: Can reptiles get the flu

    Quote Originally Posted by Deborah View Post
    Nope (species specific)
    Not entirely accurate given both pigs and birds also carry/transmit/suffer from Influenza A - hence the monikers "swine flu", "bird flu", and "avian flu"
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (03-01-2019)

  8. #5
    Registered User Danger noodles's Avatar
    Join Date
    10-15-2018
    Posts
    335
    Thanks
    38
    Thanked 195 Times in 138 Posts

    Re: Can reptiles get the flu

    Quote Originally Posted by asplundii View Post
    Not entirely accurate given both pigs and birds also carry/transmit/suffer from Influenza A - hence the monikers "swine flu", "bird flu", and "avian flu"
    Correct

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1