Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ


» Today's Birthdays

Vaughan221 (31)
Masonic (25)
Cadance (19)

» Stats

Members: 63,384
Threads: 237,208
Posts: 2,463,253
Top Poster: JLC (31,652)
Welcome to our newest member, grayhyla
Results 1 to 4 of 4
  1. #1
    Registered User
    Join Date
    01-23-2019
    Posts
    1
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Cool Help with candy/toffee gene please! Repticon Orlando tomorrow

    The genetic wizard on the major sites do not show candy/toffee genes correctly. I have a high contrast albino enchi male, I would probably like to get a candy female to pair. Would I only get candinos/candino enchi out of this? What if I bought a candy pied? The genetic wizard says I'd get "triple het albino.. And triple het albino enchi" What does this mean exactly? They'd look normal but have three 100% hets? Any help greatly appreciated. Also any suggestions would be appreciated, basically no price limit but nothing crazy like $2,500+... My goal is for yellow/purple or yellow, purple, white snakes. Thanks!

  2. #2
    Registered User Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    350
    Thanks
    203
    Thanked 380 Times in 208 Posts
    Images: 1

    Re: Help with candy/toffee gene please! Repticon Orlando tomorrow

    Albino - Recessive Trait
    Enchi - Codominant Trait
    x
    Candy - Recessive Trait
    Pied - Recessive Trait

    Off Spring:
    50% Chance of Being Enchi
    100% Chance of Being Het for Albino and Candy = Candino
    100% Chance of Being Het for Pied

    The odds of offspring from this cross will be:
    50% Candino/Het Pied
    50% Candino/Enchi/Het Pied
    *.* TNTC

  3. The Following User Says Thank You to Lord Sorril For This Useful Post:

    Shayne (01-28-2019)

  4. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    713
    Thanks
    71
    Thanked 479 Times in 263 Posts
    Sorril covered it pretty well.

    For simplicity sake, when using the MorphMarket calculator just enter 'Albino' in place of 'Candy' for your breakdowns and then just remember that your offspring will be Candinos and not the Albinos the calculator calls
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #4
    Registered User Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    350
    Thanks
    203
    Thanked 380 Times in 208 Posts
    Images: 1

    Re: Help with candy/toffee gene please! Repticon Orlando tomorrow

    Quote Originally Posted by asplundii View Post
    Sorril covered it pretty well.
    Thanks, I do like the looks of Candy Pied myself.



    Picture is from 2011 Reptile Expo--Manchester, NH.
    Last edited by Lord Sorril; 01-28-2019 at 09:45 AM.
    *.* TNTC

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1