Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,954

0 members and 2,954 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,079
Threads: 248,525
Posts: 2,568,633
Top Poster: JLC (31,651)
Welcome to our newest member, Remarkable
Page 2 of 2 FirstFirst 12
Results 11 to 14 of 14

Thread: Winter shipping

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Winter shipping

    Quote Originally Posted by MR Snakes View Post
    I have heard of this 40 hour heat pack but we routinely have overnight packages that don't make it here overnight (about 50%). So is 48 hours too long?
    FWIW there are 72hr heat packs available. I use these exclusively
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Godzilla78 (11-30-2018),MR Snakes (11-30-2018)

  3. #12
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts

    Re: Winter shipping

    the 72 hour heat packs are the best! Also, make sure NOT TO FEED them within 48 hours before shipping, and make sure they are hydrated before packing. It is always stressful for the snake, but all we can do is keep them as healthy as possible during their hellish imprisonment travels.
    Last edited by Godzilla78; 11-30-2018 at 11:12 AM.

  4. #13
    Registered User Judy@SYR's Avatar
    Join Date
    08-08-2017
    Posts
    12
    Thanks
    3
    Thanked 16 Times in 8 Posts
    Winter shipping is fine so long as packaging standards and temperature guidelines are followed during regular shipping times (ie: Not during the Christmas crush or a massive blizzard sweeping across the Midwest). You can expect live arrival.

    We also love the 72 hour heat packs. If a package gets delayed along the way, you have that extra confidence of slow, steady warmth in the box.

    Of course, the holiday crush of packages is just around the corner. Our last day of shipping with On-Time and Live Arrival Insurance available is December 4th. After that date, the chances of delayed shipments begins to rapidly escalate. After the New Year, things will return to the regular winter shipping standards.

    Don't hesitate to call or write to us if you have any questions about safe winter shipping!
    303-730-2125
    info@ShipYourReptiles.com
    (Mon - Fri, 7am - 6pm MST)
    Judy
    Director of Accounts at ShipYourReptiles

    email: Judy@ShipYourReptiles.com

    Customer Service Desk
    303-730-2125 (ext 1 or 2)
    info@ShipYourReptiles.com

  5. The Following 4 Users Say Thank You to Judy@SYR For This Useful Post:

    Armiyana (12-06-2018),asplundii (12-03-2018),Godzilla78 (12-01-2018),MR Snakes (11-30-2018)

  6. #14
    BPnet Senior Member MR Snakes's Avatar
    Join Date
    11-25-2018
    Location
    Rockbound coast of Maine, USA
    Posts
    2,667
    Thanks
    1,258
    Thanked 477 Times in 379 Posts

    Re: Winter shipping

    Quote Originally Posted by Judy@SYR View Post
    Winter shipping is fine so long as packaging standards and temperature guidelines are followed during regular shipping times (ie: Not during the Christmas crush or a massive blizzard sweeping across the Midwest). You can expect live arrival.

    We also love the 72 hour heat packs. If a package gets delayed along the way, you have that extra confidence of slow, steady warmth in the box.

    Of course, the holiday crush of packages is just around the corner. Our last day of shipping with On-Time and Live Arrival Insurance available is December 4th. After that date, the chances of delayed shipments begins to rapidly escalate. After the New Year, things will return to the regular winter shipping standards.

    Don't hesitate to call or write to us if you have any questions about safe winter shipping!
    303-730-2125
    info@ShipYourReptiles.com
    (Mon - Fri, 7am - 6pm MST)

    Thanks for the info.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1