Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,631

4 members and 1,627 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,092
Threads: 248,528
Posts: 2,568,679
Top Poster: JLC (31,651)
Welcome to our newest member, FayeZero
Page 2 of 2 FirstFirst 12
Results 11 to 20 of 20
  1. #11
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    I won't list all of them but the top 3 I am looking forward to the most are

    Pastel Leopard Yellow Belly Pied X Banana Clown (Start of a new long term projects)

    Pastel Leopard Yellow Belly Pied X Pastel Yellow Belly Pied

    Pied Het Hypo x Hypo Enchi Leopard Poss Het Pied (I am 99% sure she will prove )
    Deborah Stewart


  2. The Following 2 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    PghBall (11-12-2018),the_rotten1 (11-14-2018)

  3. #12
    BPnet Lifer PghBall's Avatar
    Join Date
    04-20-2009
    Location
    Pleasant Hills, Pennsylvania
    Posts
    2,683
    Thanks
    996
    Thanked 1,191 Times in 952 Posts
    Images: 5

    Re: What's everyone's breeding plans this season?

    Quote Originally Posted by Deborah View Post
    I won't list all of them but the top 3 I am looking forward to the most are

    Pastel Leopard Yellow Belly Pied X Banana Clown (Start of a new long term projects)

    Pastel Leopard Yellow Belly Pied X Pastel Yellow Belly Pied

    Pied Het Hypo x Hypo Enchi Leopard Poss Het Pied (I am 99% sure she will prove )
    Can't wait to see what you produce down the line! I have a male Clown het Hypo and a male Caramel Albino het Hypo I hope to get some more weight on so that they may be able to breed late this year. To some of my visual and 100% het Hypo females. Also picking up an Ultramel from Brian Breikss in a trade. Hoping to ramp up my het game in the next few years (at least beyond Pied and Hypo).
    - Greg

    Visit our Facebook page: https://www.facebook.com/412Balls/



    or our website: http://412balls.weebly.com/

  4. The Following User Says Thank You to PghBall For This Useful Post:

    Stewart_Reptiles (11-12-2018)

  5. #13
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11
    So far I've paired:
    Yellowbelly het Pied x Black Pastel het Pied
    Yellowbelly het Pied x Normal het Pied
    Enchi Pied x Mojave
    Enchi Pied x Cinnamon het Pied
    Pastel x Green Pastel

    I've also paired my Pied male with all the girls the Enchi Pied has been with, but the Enchi Pied is the only one locking with them at the moment. He and the Pastel male are doing well. The Pied and the Yellowbelly het Pied are just not getting it. It's a shame, because I really want clutches from both of them.

    Also:
    Axanthic Western Hognose x Normal Western Hognose

    These two are looking good so far. She's starting to look a little thicker near the tail.
    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


  6. The Following User Says Thank You to the_rotten1 For This Useful Post:

    PghBall (11-13-2018)

  7. #14
    BPnet Lifer PghBall's Avatar
    Join Date
    04-20-2009
    Location
    Pleasant Hills, Pennsylvania
    Posts
    2,683
    Thanks
    996
    Thanked 1,191 Times in 952 Posts
    Images: 5

    Re: What's everyone's breeding plans this season?

    Quote Originally Posted by the_rotten1 View Post
    So far I've paired:
    Yellowbelly het Pied x Black Pastel het Pied
    Yellowbelly het Pied x Normal het Pied
    Enchi Pied x Mojave
    Enchi Pied x Cinnamon het Pied
    Pastel x Green Pastel

    I've also paired my Pied male with all the girls the Enchi Pied has been with, but the Enchi Pied is the only one locking with them at the moment. He and the Pastel male are doing well. The Pied and the Yellowbelly het Pied are just not getting it. It's a shame, because I really want clutches from both of them.

    Also:
    Axanthic Western Hognose x Normal Western Hognose

    These two are looking good so far. She's starting to look a little thicker near the tail.
    Cool, can't go wrong with Pieds! It's still early in the season. Sometimes it just takes them awhile to get going. I have only witnessed two confirmed locks myself so far.
    - Greg

    Visit our Facebook page: https://www.facebook.com/412Balls/



    or our website: http://412balls.weebly.com/

  8. #15
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11

    Re: What's everyone's breeding plans this season?

    Quote Originally Posted by PghBall View Post
    Cool, can't go wrong with Pieds! It's still early in the season. Sometimes it just takes them awhile to get going. I have only witnessed two confirmed locks myself so far.
    Thanks! Technically, I've been breeding them for awhile now. I breed year round, but I'm hoping that their natural breeding season will help get them in the mood.

    I've been trying to get the Pied to breed for two years now. He just doesn't seem interested. This is the first year for the Yellowbelly het Pied, but at least he's getting close. I've seen him tail to tail with the Normal het Pied girl a few times, just not quite locked.

    I love pieds, so they're in most of my projects. I had three clutches with pied in them this year and I'm hoping for more in 2019. Can't get enough of them!
    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


  9. The Following User Says Thank You to the_rotten1 For This Useful Post:

    PghBall (11-15-2018)

  10. #16
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts
    Super pastel pied 1.0
    [IMG][/IMG]
    and pied 0.1
    [IMG][/IMG]

  11. The Following 3 Users Say Thank You to Godzilla78 For This Useful Post:

    Dianne (11-14-2018),PghBall (11-15-2018),the_rotten1 (11-15-2018)

  12. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Butter Enchi OD Pastel YB x male1 (128 possible combos)
    Hypo Lesser/Mojave x male1 (8 or 16 possible combos [depending on if male is het Hypo])
    RedStripe x male1 (8 possible combos)
    Albino Woma x male1 (8 possible combos)

    Mojave x GStripe RedStripe (4 possible combos)
    RedStripe het GStripe x GStripe RedStripe (6 possible combos)
    Female 1 x GStripe RedStripe (4 possible combos)

    Mojave het Albino x male2 (8 possible combos)

    OD Pastel YB x male3 (24 possible combos)

    Albino Pin x male4 (8 possible combos)
    WT x male4 (4 possible combos))

    Dinker female x Banana "het Dinker"
    Dinker female x "het Dinker"

    "het Dinker" female x Banana "het Dinker"
    "het Dinker" female x "het Dinker"
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. The Following User Says Thank You to asplundii For This Useful Post:

    PghBall (11-15-2018)

  14. #18
    Registered User
    Join Date
    11-10-2018
    Location
    DFW, TX
    Posts
    113
    Thanks
    19
    Thanked 108 Times in 58 Posts
    Images: 4
    This year I've just got 1 pairing, since it's my first year back breeding after quite a hiatus, so I'm easing myself back in.

    It's a 1.0 Butter Enchi Pastel x Pastave Bee.

    There's a ton of possibilities, so my dream is a longshot, but I'd LOVE to see a White Walker come out of an egg next year.

    Here's the WOBP page for reference: http://www.worldofballpythons.com/mo...-white-walker/

  15. The Following User Says Thank You to RXLReptiles For This Useful Post:

    PghBall (11-19-2018)

  16. #19
    Registered User KodeyEH's Avatar
    Join Date
    03-23-2018
    Location
    Calgary, Alberta
    Posts
    20
    Thanks
    27
    Thanked 24 Times in 12 Posts

    Re: What's everyone's breeding plans this season?

    Man you guys have some crazy things in the works, I'm just getting back into breeding after having some health issues so here's what I've got going on:

    M x F
    DH Albino Pied x DH Albino Pied about to drop eggs at the end of this month! (Bought her while she was building and 2 months prior to her ovulation).
    Pastel x Dinker (I wanted to give her a basic male just in case she turns out to be something to make it easier to tell lol, she just ovulated on the 11th of this month)
    Albino x Enchi (Making Enchi hets for the future)
    Het Pied x Het Pied (Been trying to throw in my Banana Het Pied but he's not interested)

    If these females get some more size on them then I'll be following through on these pairings as well

    Banana LemonBlast (he still needs some size) x QueenBee (She's at 1500g but I'd like to see her hit 1600g)
    Banana Het Pied x Piebald (she's sitting at 1300g)
    Albino x Albino (she's at 1200g)

    I also bought a Cinnamon female that was paired with a Cinny Caramel and a Savannah Het Caramel, she doesn't seem like she's taken to them but we'll see. Best of luck to all of you, I can't wait to see the crazy things you guys produce!

  17. The Following 2 Users Say Thank You to KodeyEH For This Useful Post:

    PghBall (11-20-2018),the_rotten1 (11-20-2018)

  18. #20
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: What's everyone's breeding plans this season?

    Im fixed...


    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  19. The Following 4 Users Say Thank You to CALM Pythons For This Useful Post:

    Godzilla78 (11-20-2018),KodeyEH (11-20-2018),PghBall (11-20-2018),zina10 (11-20-2018)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1