Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,506

3 members and 1,503 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,533
Posts: 2,568,692
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Results 1 to 7 of 7

Thread: Black Morph

  1. #1
    BPnet Veteran Jbabycsx's Avatar
    Join Date
    10-07-2018
    Posts
    418
    Thanks
    217
    Thanked 400 Times in 195 Posts

    Black Morph

    Something I’ve been thinking about while I’m at work. I’ve been searching around the internet trying to figure out what it would take to create a black morph. I know there are morphs that are very dark, however, I mean black. No pattern at all.

    If you were going to make this your mission in the hobby, what would you use as a base to start out? (Assuming it’s even possible)


    Sent from my iPhone using Tapatalk

  2. #2
    BPnet Senior Member StillBP's Avatar
    Join Date
    08-13-2015
    Location
    Pittsburgh PA
    Posts
    1,541
    Thanks
    464
    Thanked 1,034 Times in 657 Posts

    Re: Black Morph

    Quote Originally Posted by Jbabycsx View Post
    Something I’ve been thinking about while I’m at work. I’ve been searching around the internet trying to figure out what it would take to create a black morph. I know there are morphs that are very dark, however, I mean black. No pattern at all.

    If you were going to make this your mission in the hobby, what would you use as a base to start out? (Assuming it’s even possible)


    Sent from my iPhone using Tapatalk
    To make a black ball python you use either a black pastel a cinnamon or Mahogany. If you were starting out specifically for a black morph go with a mahogany because while slightly more expensive than black pastel and cinnamon the babies don't have the kinking issues that super black pastel and super cinnamon are known for. when you breed you breed to another mahogany to make a super mahogany and it is an almost black snake but if you throw a black pastel gene or a cinnamon gene on top of that they are jet black. black pastel and cinnamon in super form make a solid black snake but the babies have a chance to be duck-billed or kinked

    Sent from my XT1635-01 using Tapatalk
    Laziness is nothing more than the habit of resting before you get tired.

  3. The Following User Says Thank You to StillBP For This Useful Post:

    Ronniex2 (08-12-2021)

  4. #3
    Registered User Direpython's Avatar
    Join Date
    09-08-2018
    Posts
    154
    Thanks
    3
    Thanked 48 Times in 34 Posts
    Images: 8

    Re: Black Morph

    Quote Originally Posted by Jbabycsx View Post
    Something I’ve been thinking about while I’m at work. I’ve been searching around the internet trying to figure out what it would take to create a black morph. I know there are morphs that are very dark, however, I mean black. No pattern at all.

    If you were going to make this your mission in the hobby, what would you use as a base to start out? (Assuming it’s even possible)


    Sent from my iPhone using Tapatalk
    Probably your best bet would be cinnamon x cinnamon for super or black pastel to black pastel would make super black pastel. That’s is the two closest all black ball pythons but from what I understand that is generally a lethal combo. Lots of kinking and deaths from that combination. I think they have fixed that issue. With lower temps and longer incubation times lowers the risk of duck billing and kinking in these supers.


    Sent from my iPhone using Tapatalk

  5. #4
    Registered User Roux's Avatar
    Join Date
    06-22-2017
    Posts
    136
    Thanks
    40
    Thanked 70 Times in 52 Posts

    Re: Black Morph

    Other options; huffman, blackhead, and chocolate those seem to be the up and coming morphs breeders are trying for an all black bp. They in themselves dont make all black, but mixed with the right things they could.

    Sent from my SM-G930V using Tapatalk

  6. #5
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: Black Morph

    The blackest black and safest as far as not have the high chance of kinking or jaw deformities that Ive seen would be a suma with either cinny or bp added. All other super forms of those tend to be more dark brown, have dorsal stripes or with the super cinny/bp speckling. They also look more brown with age even if they look black at hatch. This is a het pied suma I hatched. She has a pretty noticeable stripe but I intend to add my cinny pied to the project to darken up the final morph. Ill have to take a newer pic because i think she looks more super dark brown than this irl

    Sent from my SM-G920T using Tapatalk

  7. The Following 6 Users Say Thank You to Hannahshissyfix For This Useful Post:

    Dianne (10-28-2018),Jbabycsx (10-28-2018),Ronniex2 (08-12-2021),RoyalLover (11-23-2018),SKK_Reptiles (12-04-2018),the_rotten1 (11-15-2018)

  8. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    The Suma Cinny is very dark but I think the Abyss (Suma GHI) might be darker. I saw the prior in the flesh a few years ago at Tinley and there was still a hint of dark brown to it under the right light.

    Give the trend I would guess that Suma BlackHead and Suma Chocolate will have the potential to be very dark as well. I would also bank on any of the aforementioned single genes making something dark when in combo with the SuperCinder
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #7
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts
    Black axanthics are amazing. big money though, not very common.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1