» Site Navigation
0 members and 3,275 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,533
Posts: 2,568,700
Top Poster: JLC (31,651)
|
-
Black Morph
Something I’ve been thinking about while I’m at work. I’ve been searching around the internet trying to figure out what it would take to create a black morph. I know there are morphs that are very dark, however, I mean black. No pattern at all.
If you were going to make this your mission in the hobby, what would you use as a base to start out? (Assuming it’s even possible)
Sent from my iPhone using Tapatalk
-
-
Re: Black Morph
Originally Posted by Jbabycsx
Something I’ve been thinking about while I’m at work. I’ve been searching around the internet trying to figure out what it would take to create a black morph. I know there are morphs that are very dark, however, I mean black. No pattern at all.
If you were going to make this your mission in the hobby, what would you use as a base to start out? (Assuming it’s even possible)
Sent from my iPhone using Tapatalk
To make a black ball python you use either a black pastel a cinnamon or Mahogany. If you were starting out specifically for a black morph go with a mahogany because while slightly more expensive than black pastel and cinnamon the babies don't have the kinking issues that super black pastel and super cinnamon are known for. when you breed you breed to another mahogany to make a super mahogany and it is an almost black snake but if you throw a black pastel gene or a cinnamon gene on top of that they are jet black. black pastel and cinnamon in super form make a solid black snake but the babies have a chance to be duck-billed or kinked
Sent from my XT1635-01 using Tapatalk
Laziness is nothing more than the habit of resting before you get tired.
-
The Following User Says Thank You to StillBP For This Useful Post:
-
Registered User
Re: Black Morph
Originally Posted by Jbabycsx
Something I’ve been thinking about while I’m at work. I’ve been searching around the internet trying to figure out what it would take to create a black morph. I know there are morphs that are very dark, however, I mean black. No pattern at all.
If you were going to make this your mission in the hobby, what would you use as a base to start out? (Assuming it’s even possible)
Sent from my iPhone using Tapatalk
Probably your best bet would be cinnamon x cinnamon for super or black pastel to black pastel would make super black pastel. That’s is the two closest all black ball pythons but from what I understand that is generally a lethal combo. Lots of kinking and deaths from that combination. I think they have fixed that issue. With lower temps and longer incubation times lowers the risk of duck billing and kinking in these supers.
Sent from my iPhone using Tapatalk
-
-
Registered User
Re: Black Morph
Other options; huffman, blackhead, and chocolate those seem to be the up and coming morphs breeders are trying for an all black bp. They in themselves dont make all black, but mixed with the right things they could.
Sent from my SM-G930V using Tapatalk
-
-
Re: Black Morph
The blackest black and safest as far as not have the high chance of kinking or jaw deformities that Ive seen would be a suma with either cinny or bp added. All other super forms of those tend to be more dark brown, have dorsal stripes or with the super cinny/bp speckling. They also look more brown with age even if they look black at hatch. This is a het pied suma I hatched. She has a pretty noticeable stripe but I intend to add my cinny pied to the project to darken up the final morph. Ill have to take a newer pic because i think she looks more super dark brown than this irl
Sent from my SM-G920T using Tapatalk
-
The Following 6 Users Say Thank You to Hannahshissyfix For This Useful Post:
Dianne (10-28-2018),Jbabycsx (10-28-2018),Ronniex2 (08-12-2021),RoyalLover (11-23-2018),SKK_Reptiles (12-04-2018),the_rotten1 (11-15-2018)
-
The Suma Cinny is very dark but I think the Abyss (Suma GHI) might be darker. I saw the prior in the flesh a few years ago at Tinley and there was still a hint of dark brown to it under the right light.
Give the trend I would guess that Suma BlackHead and Suma Chocolate will have the potential to be very dark as well. I would also bank on any of the aforementioned single genes making something dark when in combo with the SuperCinder
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Black axanthics are amazing. big money though, not very common.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|