Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,694

1 members and 2,693 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,092
Threads: 248,528
Posts: 2,568,679
Top Poster: JLC (31,651)
Welcome to our newest member, FayeZero
Page 2 of 2 FirstFirst 12
Results 11 to 13 of 13
  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Does this look like a woma fire yellowbelly

    Quote Originally Posted by rufretic View Post
    On most enchi combos I agree with you but out of the enchi woma and super enchi womas I've seen, it doesn't seem to have that same yellowing effect, they stay more of a brown tan.
    Quote Originally Posted by rufretic View Post
    On this animal the pattern is just so reduced, I would think it had enchi if not super enchi. Because of its light color and blushed head stamp I do believe it has fire. What I'm not seeing is yellow belly. If it did have enchi and yellow belly, then I would think it would have more yellow coloring but yellow belly is a hard one for me.
    Quote Originally Posted by Godzilla78 View Post
    I concur. Definite super enchi woma with that awesome reduction!
    Quote Originally Posted by rufretic View Post
    What I'm not seeing is yellow belly. If it did have enchi and yellow belly, then I would think it would have more yellow coloring but yellow belly is a hard one for me.


    Rufretic, Godzilla,

    With respect, might I ask if either of you actually work with the Woma morph?

    I have been working with Woma for the past eleven years so I do kind of have an eye for things that they do when in combo.

    Most of the pics of Enchi Woma and SuperEnchi Woma are low-quality ones posted by one big breeders. His animals are not the norm.

    You both focus on how reduced the animal is. I have produced both single gene and combo Womas without any Enchi in them that are as reduced as that animal. YB when paired with Woma, in a somewhat contradiction to its normal behaviour in combos, tends to reduce the pattern and deepen the blacks on the animals. The bellies on WomaYB stay clean so they are nearly worthless in helping the ID.



    Dolo,

    Can you ask the breeder what the pairing was that made this animal? If there is no Enchi in either parent then there would be no point in continuing to argue about whether or not this is and Enchi Woma or SuperEnchi Woma.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Dolo (05-31-2019),rufretic (05-28-2019)

  3. #12
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Does this look like a woma fire yellowbelly

    Quote Originally Posted by asplundii View Post
    Rufretic, Godzilla,

    With respect, might I ask if either of you actually work with the Woma morph?

    I have been working with Woma for the past eleven years so I do kind of have an eye for things that they do when in combo.

    Most of the pics of Enchi Woma and SuperEnchi Woma are low-quality ones posted by one big breeders. His animals are not the norm.

    You both focus on how reduced the animal is. I have produced both single gene and combo Womas without any Enchi in them that are as reduced as that animal. YB when paired with Woma, in a somewhat contradiction to its normal behaviour in combos, tends to reduce the pattern and deepen the blacks on the animals. The bellies on WomaYB stay clean so they are nearly worthless in helping the ID.



    Dolo,

    Can you ask the breeder what the pairing was that made this animal? If there is no Enchi in either parent then there would be no point in continuing to argue about whether or not this is and Enchi Woma or SuperEnchi Woma.
    Thank you for this helpful explanation, your experience has much more value than me just trying to help based off pictures. I did mention I do not have experience with woma but I am always interested in learning more so thank you for sharing your experience.

  4. The Following User Says Thank You to rufretic For This Useful Post:

    asplundii (05-29-2019)

  5. #13
    Registered User
    Join Date
    05-30-2011
    Posts
    7
    Thanks
    2
    Thanked 2 Times in 2 Posts

    Re: Does this look like a woma fire yellowbelly

    Quote Originally Posted by asplundii View Post
    Rufretic, Godzilla,

    With respect, might I ask if either of you actually work with the Woma morph?

    I have been working with Woma for the past eleven years so I do kind of have an eye for things that they do when in combo.

    Most of the pics of Enchi Woma and SuperEnchi Woma are low-quality ones posted by one big breeders. His animals are not the norm.

    You both focus on how reduced the animal is. I have produced both single gene and combo Womas without any Enchi in them that are as reduced as that animal. YB when paired with Woma, in a somewhat contradiction to its normal behaviour in combos, tends to reduce the pattern and deepen the blacks on the animals. The bellies on WomaYB stay clean so they are nearly worthless in helping the ID.



    Dolo,

    Can you ask the breeder what the pairing was that made this animal? If there is no Enchi in either parent then there would be no point in continuing to argue about whether or not this is and Enchi Woma or SuperEnchi Woma.
    I called and texted him yesterday. Haven't heard back. I'm pretty sure he wasn't the original breeder because he was selling 6 ball pythons. They were different gene snakes. I know 4 of them Fire Woma YB, Het Pied, Enchi G-Stripe and "Volta". He told me him and his wife wanted to sell the ball pythons and get into hognoses.

    I posted this because when we met up something seemed off about him. When I started asking for background info on the "Volta" then all of sudden he remembered it was sold. I realize it wasn't the smartest move to purchase an animal off of Craiglist but I don't have any regrets. She's a great eater plus awesome to look at when I take her out.

    Thank you guys for taking your time out posting.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1