Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 422

6 members and 416 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.


» Today's Birthdays

None

» Stats

Members: 69,668
Threads: 244,032
Posts: 2,529,992
Top Poster: JLC (31,651)
Welcome to our newest member, xivExotics
Results 1 to 8 of 8
  1. #1
    BPnet Veteran cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,045 Times in 621 Posts
    Images: 16

    Where to buy deli cups to sell ball python hatchlings

    I know this was posted before but I was wondering if someone could point me to a website where I can buy deli cups to sell ball pythons, the ones used as a container to take a snake home from a show. I'm doing my first show next month, the COEPE, Colorado Exotic Pet Expo. I should have 60 snakes for sale! I'm getting ready to put in an order for my ARS display cases, and I'm already signed up for a table at the show. So far I have 75 hatchlings, and I'm thinking of holding back 14 as future breeders. The rest will be at the show on the 9th of September, 2018.

    There was a good thread listing all the supplies needed for a show but I can't seem to find that one...


  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    881
    Thanks
    94
    Thanked 665 Times in 359 Posts
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    AbsoluteApril (08-08-2018),C.Marie (08-08-2018)

  4. #3
    Temporarily Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,554
    Thanks
    14,288
    Thanked 11,006 Times in 5,315 Posts
    I'm not sure if you'll find the right ones, but you could try restaurant supply companies. In just not sure if they carry anything that would have the proper veneration holes.

  5. #4
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,838
    Thanks
    6,115
    Thanked 20,786 Times in 9,579 Posts
    Blog Entries
    1
    Images: 6
    You have your choice

    TSK
    Ship Your Reptiles
    Reptiles Express
    Superior Shipping Supplies

    You are looking at 6.75 pre-punched if you want to use deli cups also must people selling ball pythons use bags.
    Deborah Stewart

  6. The Following User Says Thank You to Stewart_Reptiles For This Useful Post:

    C.Marie (08-08-2018)

  7. #5
    Sometimes It Hurts... PitOnTheProwl's Avatar
    Join Date
    11-21-2010
    Location
    San Antonio, TX
    Posts
    12,039
    Thanks
    6,289
    Thanked 6,976 Times in 4,269 Posts
    Images: 3
    Ace Mart restaurant supply is where I get mine.

  8. The Following User Says Thank You to PitOnTheProwl For This Useful Post:

    C.Marie (08-08-2018)

  9. #6
    BPnet Veteran Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    12,534
    Thanks
    17,666
    Thanked 10,326 Times in 6,579 Posts
    It's a bit of a hassle, but if you must use deli cups that aren't pre-punched, all you need is a little time & a hole-puncher (from office supply store).

  10. #7
    Sometimes It Hurts... PitOnTheProwl's Avatar
    Join Date
    11-21-2010
    Location
    San Antonio, TX
    Posts
    12,039
    Thanks
    6,289
    Thanked 6,976 Times in 4,269 Posts
    Images: 3

    Re: Where to buy deli cups to sell ball python hatchlings

    Quote Originally Posted by Bogertophis View Post
    It's a bit of a hassle, but if you must use deli cups that aren't pre-punched, all you need is a little time & a hole-puncher (from office supply store).
    Stack the lids and a good hot 5w soldering iron or back them with an old 2x4 and a 1/4" drill bit. Done it both ways.

  11. The Following 3 Users Say Thank You to PitOnTheProwl For This Useful Post:

    AbsoluteApril (08-08-2018),C.Marie (08-08-2018),IsmQui718 (11-07-2018)

  12. #8
    BPnet Veteran cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,045 Times in 621 Posts
    Images: 16
    Thanks for all your input! I decided to get the ones from TSK supply. I think all of the hatchlings that I bought here in Colorado came in the same exact deli cup with holes. Plus if I have some overflow on my table I can display some snakes in these deli cups too.


Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1