Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,279

1 members and 3,278 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,535
Posts: 2,568,703
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 28
  1. #11
    Registered User Sirus Uno's Avatar
    Join Date
    07-02-2018
    Location
    Kissimmee, FL.
    Posts
    89
    Thanks
    84
    Thanked 45 Times in 29 Posts
    Looks like this is a subject that really needs to get hashed out and clarified. I know there's more! Recently I've seen too many "new" genes which are obviously other genes renamed or mixes all muddled up that are unidentified and people just want to put a new label on instead of figuring out the original genetics involved in the combos.
    **LU BALLZ** (IG. @lu_ballz)

  2. The Following 2 Users Say Thank You to Sirus Uno For This Useful Post:

    Hannahshissyfix (08-30-2018),Lord Sorril (07-25-2018)

  3. #12
    Registered User Roux's Avatar
    Join Date
    06-22-2017
    Posts
    136
    Thanks
    40
    Thanked 70 Times in 52 Posts

    Re: Same genes, different names...?

    Here are some off the top of my head:
    I just bought 2 'paint' gene snakes. I believe that is the same as 'nazca'. And i think theres another out there that is similar.

    I have heard recently people calling fire and vanilla the same but i think theyre just allelic?

    Many people suggest black pastel and cinnamon are the same, but i myself disagree on that one.

    Gravel and yellowbelly are virtually indistinguishable except in super form. They are allelic as well.

    Hypo, ghost, and orange ghost are accepted by most to be the same gene, but the line varies the color vivacity.

    Sugar and calico are the same.

    Disclaimer i am not an expert please correct me if i am wrong here lol.


    Sent from my SM-G930V using Tapatalk

  4. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Same genes, different names...?

    Quote Originally Posted by JodanOrNoDan View Post
    subtle differences can often be remarked on, however there are always other genes at play that can change the appearance of the snake.
    And do not forget the effects of selective/line breeding (even if it is done subconsciously) which can also influence "differences"


    Quote Originally Posted by Avsha531 View Post
    Toffee/Candy?
    Toffee and Candy are absolutely the same. The original two animals were imported at the same time in the same bag and were siblings.


    Quote Originally Posted by Roux View Post
    I just bought 2 'paint' gene snakes. I believe that is the same as 'nazca'. And i think theres another out there that is similar.
    Neo (from RDR) and Sentinel (from Bill Stegal). Mark Haas had one too, cannot remember what it was called


    Quote Originally Posted by Roux View Post
    I have heard recently people calling fire and vanilla the same but i think theyre just allelic?
    Vanilla and Fire are allelic but definitely not the same, SuperVanilla are nothing like SuperFire.


    Quote Originally Posted by Roux View Post
    Many people suggest black pastel and cinnamon are the same, but i myself disagree on that one.
    I agree with you that BlkPastel and Cinny are different but there are others in the complex that are most likely the same, like HRA and GreenPastel and Lori

    I will also note that there are multiple lines of both BlkPastel and Cinny that have been imported.

    Quote Originally Posted by Roux View Post
    Hypo, ghost, and orange ghost are accepted by most to be the same gene, but the line varies the color vivacity.
    A caution here that there are some lines of Hypo that are not compatible. GCR-line Hypo has proven to be non-compatible and Graziani has two lines of Hypo (G1 and G2) that are also totally separate
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following User Says Thank You to asplundii For This Useful Post:

    Sirus Uno (07-28-2018)

  6. #14
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    6,952
    Thanks
    2,510
    Thanked 4,899 Times in 2,993 Posts

    Re: Same genes, different names...?

    In the uk we have Toffino but I think you call it something like Pastel Banana or something..


    Sent from my iPhone using Tapatalk Pro




  7. #15
    BPnet Veteran Avsha531's Avatar
    Join Date
    03-22-2018
    Location
    North Jersey
    Posts
    681
    Thanks
    704
    Thanked 568 Times in 291 Posts

    Re: Same genes, different names...?

    Quote Originally Posted by Zincubus View Post
    In the uk we have Toffino but I think you call it something like Pastel Banana or something..


    Sent from my iPhone using Tapatalk Pro
    I can see where you would see the similarities, but over here Candino/ Toffino is an ALS animal that is het Albino and het Candy/Toffee

    Sent from my SM-G950U using Tapatalk
    1.0 Kenyan Sand Boa - Sir Hiss🎩🐍
    0.1 Pastel Ball Python - Exzahrah
    0.1 Brazilian Rainbow Boa - Nymeria
    0.1 Suriname Red Tail BCC- Sascha
    0.1 WT Ball Python- Ariana
    1.0 Bumblebee Ball Python- Fabio

    WISHLIST:
    Dumerils Boa
    Candino BP
    Granite IJ Carpet Python
    White Lipped Python
    Komodo Dragon


    "​Normal is just a setting on the washing machine..."

  8. #16
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,455
    Thanks
    622
    Thanked 3,197 Times in 1,091 Posts
    Images: 84

    Re: Same genes, different names...?

    Quote Originally Posted by Sirus Uno View Post
    Looks like this is a subject that really needs to get hashed out and clarified. I know there's more! Recently I've seen too many "new" genes which are obviously other genes renamed or mixes all muddled up that are unidentified and people just want to put a new label on instead of figuring out the original genetics involved in the combos.
    I agree with you 100%!
    *.* TNTC

  9. The Following User Says Thank You to Lord Sorril For This Useful Post:

    Sirus Uno (07-28-2018)

  10. #17
    BPnet Veteran ElliotNess's Avatar
    Join Date
    05-28-2014
    Posts
    690
    Thanks
    2
    Thanked 426 Times in 263 Posts
    The real problem now is those that identify their "own line" of a gene. There are so many fire lines. If they are all compatible = same line. Axanthic actually has lines that when bred together are NOT compatible. That should be what determines a line. I watched a YT video and this guy bought a CB animal from someone and he said it looks like it has fire too and then went on to say he would name it his fire line. WTF.

    Banana/Coral Glow
    Calico/Sugar
    Mystic/Phantom
    Butter/Lesser

    All of the name changes are miraculously found when the price dropped. Lessers dropped in price and then all of a sudden Sugar appeared at 3x the cost.

    These people with these new genes aren't hand importing wild animals, they are buying CB animals and when YB or something pops up, its a new gene. So many want to be the first, coolest, most followers and likes and have no idea what they are talking about.

    Someone made a video and said "this just means its 66% that its 100% het" and all I could think of is "It's called Sex Panther by Odeon. They've done studies, you know. 60% of the time, it works every time." So many experts are just regurgitating others and it spreads like wildfire which is why all of these "NEW" genes. I counted 17 IG posts in the last 3 weeks with said new genes.
    "Passion Breeds Quality, Quality Breeds Desire" - Tim

  11. The Following 3 Users Say Thank You to ElliotNess For This Useful Post:

    Godzilla78 (09-15-2018),Hannahshissyfix (08-30-2018),Sirus Uno (07-28-2018)

  12. #18
    Registered User Sirus Uno's Avatar
    Join Date
    07-02-2018
    Location
    Kissimmee, FL.
    Posts
    89
    Thanks
    84
    Thanked 45 Times in 29 Posts

    Re: Same genes, different names...?

    Lmao! Sex panther!
    I agree. I understand years of line breeding some specific traits and creating your own line of a base gene... Like Brian Gundy and his gold blush Mojave. Seems like some of the bigger breeders are changing the name of a gene to suit their style... I'd hate to name drop right now because honestly they've done so much in regards to the development of the reptile hobby and create some really amazing animals... But some of the ball pythons have so many genes in them they even have a hard time figuring all the factors involved. With that being said... Isn't fire/flame/sulfur the same?
    **LU BALLZ** (IG. @lu_ballz)

  13. #19
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11

    Re: Same genes, different names...?

    Quote Originally Posted by Sirus Uno View Post
    I understand years of line breeding some specific traits and creating your own line of a base gene... Like Brian Gundy and his gold blush Mojave.
    Didn't the gold blush turn out to be a separate gene though? Sort of like blade came out of clown and leopard showed up in het pieds. It's interesting how some genes can mask the appearance of others.

    If there's anything I've learned over the last couple of years it's that there's so much variety even within a given morph. You can have two snakes with the same genes but they look drastically different from each other. I think if anything odd showed up in my collection I'd do my due diligence to prove whether or not it was something that's already out there before I slapped a new label on it. There's no reason we need half a dozen lines of fire or pastel.
    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


  14. The Following 2 Users Say Thank You to the_rotten1 For This Useful Post:

    Hannahshissyfix (08-30-2018),Sirus Uno (08-22-2018)

  15. #20
    Registered User Sirus Uno's Avatar
    Join Date
    07-02-2018
    Location
    Kissimmee, FL.
    Posts
    89
    Thanks
    84
    Thanked 45 Times in 29 Posts
    I was recently looking on morph market and read that the Goblin is a Ralph Davis line of yellow belly. I'm guessing its been line bred to produce a more extreme variation of the coloration and patterning than a regular yb.
    I have a hard time with most of those morphs. Many of them seem like variations of classic bp's. At least until they're mixed with other genes... For the most part. Some of them don't even tweak the gene they're being mixed into though.
    **LU BALLZ** (IG. @lu_ballz)

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1