Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,488

2 members and 3,486 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,095
Threads: 248,538
Posts: 2,568,722
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 25

Thread: White Snakes

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: White Snakes

    Quote Originally Posted by Turbo Serpent View Post
    Almost every super or ALS created from the BlkEL or BluEL has the ability to be "pure" white, but can also have pattern.
    I will disagree with you here, there are some combos within each group that will never be pure white (like SuperPhantom or SuperVanilla).


    Quote Originally Posted by Turbo Serpent View Post
    not sure what dictates the bleed through of the pattern in some but not others.
    It is determined by the "strength" of the allele(s) you are working with, "stronger" alleles (e.g., more highly expressed mutation) will give reduce the likelihood of patterning/colouring arising. Lesser is stronger than Mojave is stronger than Phantom and so SuperLesser is less patterned/coloured than SuperMojave is less patterned/coloured than Phantom.


    Quote Originally Posted by JodanOrNoDan View Post
    I am getting ready to do a bucket of white snakes picture. Waiting on one to come out of the egg. No two of the same combo. Will be interesting to see the opinions on the "whitest".
    This will be interesting to see however I think you already know my caution that what these animals look like as hatchlings can be very different to how they look as adults. What people say is the "whitest" at 100g could look very different at 1000g.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Ronniex2 (07-25-2018),the_rotten1 (08-13-2018)

  3. #12
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: White Snakes

    Did someone say white snake? Could not resist.



    Sent from my N9560 using Tapatalk
    Last edited by Skyrivers; 07-24-2018 at 08:44 AM.

  4. The Following 3 Users Say Thank You to Skyrivers For This Useful Post:

    Lord Sorril (07-24-2018),Ronniex2 (07-25-2018),Sirus Uno (08-13-2018)

  5. #13
    BPnet Veteran
    Join Date
    12-04-2017
    Location
    Durban, South Africa
    Posts
    297
    Thanks
    149
    Thanked 196 Times in 105 Posts
    JodanOrNoDan, I wait in anticipation for those pics.
    Ball Pythons
    1.0 Pinstripe
    1.0 Coral Glow Pastel
    1.0 Ginger Enchi
    1.0 Spectre
    1.0 BlackPastel Yellowbelly
    1.0 Albino
    1.0 Fire
    1.0 Enchi Mojave
    1.0 Enchi
    1.0 Calico
    1.0 Leopard
    0.1 Mojave Spider
    0.1 Butter
    0.2 Fire
    0.1 Yellow Belly
    0.2 Pastel
    0.3 Normal
    0.1 Bumblebee
    0.1 Mystic
    0.1 Enchi
    0.1 Pinstripe 66% het Pied
    0.1 Leopard

    Other Pythons
    1.0 Carpet Pythons

    BOAS
    1.1 Dumerils
    2.2 Red Tail


    Corns
    1.2 Amel

  6. #14
    BPnet Veteran
    Join Date
    12-04-2017
    Location
    Durban, South Africa
    Posts
    297
    Thanks
    149
    Thanked 196 Times in 105 Posts

    Wink

    @SkyRivers
    Ball Pythons
    1.0 Pinstripe
    1.0 Coral Glow Pastel
    1.0 Ginger Enchi
    1.0 Spectre
    1.0 BlackPastel Yellowbelly
    1.0 Albino
    1.0 Fire
    1.0 Enchi Mojave
    1.0 Enchi
    1.0 Calico
    1.0 Leopard
    0.1 Mojave Spider
    0.1 Butter
    0.2 Fire
    0.1 Yellow Belly
    0.2 Pastel
    0.3 Normal
    0.1 Bumblebee
    0.1 Mystic
    0.1 Enchi
    0.1 Pinstripe 66% het Pied
    0.1 Leopard

    Other Pythons
    1.0 Carpet Pythons

    BOAS
    1.1 Dumerils
    2.2 Red Tail


    Corns
    1.2 Amel

  7. #15
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: White Snakes

    Quote Originally Posted by asplundii View Post
    This will be interesting to see however I think you already know my caution that what these animals look like as hatchlings can be very different to how they look as adults. What people say is the "whitest" at 100g could look very different at 1000g.
    Not only that, but it seems to be also influenced by the time of year and where they are in the shed cycle. Mojave complex BEL's hatch out light pink. I am not sure about YB or fire. I should have an Ivory baby this year. No babies in the fire complex though. That is next year.

    In any case, I should have enough white animals of various ages and gene combos to have a little fun with. My original "operation" was designed to make RELs in as many combos as possible. Off of the top of my head, I think I have six clutches this year that will contain white snakes. All my other projects are being done to finance making the white snakes. LOL
    Honest, I only need one more ...

  8. The Following User Says Thank You to JodanOrNoDan For This Useful Post:

    Ronniex2 (07-25-2018)

  9. #16
    BPnet Veteran Turbo Serpent's Avatar
    Join Date
    03-18-2009
    Location
    Silverdale, WA
    Posts
    1,841
    Thanks
    535
    Thanked 476 Times in 377 Posts
    Images: 1

    Re: White Snakes

    Quote Originally Posted by asplundii View Post
    I will disagree with you here, there are some combos within each group that will never be pure white (like SuperPhantom or SuperVanilla).
    That is why I prefaced it by saying almost every super or ALS.


    Quote Originally Posted by asplundii View Post
    It is determined by the "strength" of the allele(s) you are working with, "stronger" alleles (e.g., more highly expressed mutation) will give reduce the likelihood of patterning/colouring arising. Lesser is stronger than Mojave is stronger than Phantom and so SuperLesser is less patterned/coloured than SuperMojave is less patterned/coloured than Phantom.
    I understand, but I would love to see a genetic comparison between them, although they are allelic, maybe the strongest of them all would actually be the alleles that provide the non white supers. But again its all speculation until we could breakdown each morph to basic levels to look. This is one of the reasons why I love all of this, its very fascinating how it all works and how we can influence each aspect of it by introducing modifier genes for color and pattern.
    1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
    0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown

  10. The Following User Says Thank You to Turbo Serpent For This Useful Post:

    Ronniex2 (07-25-2018)

  11. #17
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: White Snakes

    Quote Originally Posted by asplundii View Post
    I will disagree with you here, there are some combos within each group that will never be pure white (like SuperPhantom or SuperVanilla).
    Super Fire also has yellow markings along the back.

  12. #18
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    6,952
    Thanks
    2,510
    Thanked 4,899 Times in 2,993 Posts

    Re: White Snakes

    Quote Originally Posted by Skyrivers View Post
    Did someone say white snake? Could not resist.



    Sent from my N9560 using Tapatalk
    Great group , great songs and he had an amazing 'spoken' voice ..
    Very 'well spoken' as I recall ..

    I still recall 'that' video featuring his super-model u


    Sent from my iPhone using Tapatalk Pro




  13. #19
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    6,952
    Thanks
    2,510
    Thanked 4,899 Times in 2,993 Posts

    Re: White Snakes

    Quote Originally Posted by Zincubus View Post
    Great group , great songs and he had an amazing 'spoken' voice ..
    Very 'well spoken' as I recall ..

    I still recall 'that' video featuring his super-model girlfriend and a car ..




    Sent from my iPhone using Tapatalk Pro


    Sent from my iPhone using Tapatalk Pro




  14. #20
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    imma just leave these two here:

    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  15. The Following 5 Users Say Thank You to Ax01 For This Useful Post:

    JodanOrNoDan (07-25-2018),Reptilius (07-31-2018),Ronniex2 (07-25-2018),the_rotten1 (08-13-2018),Turbo Serpent (07-24-2018)

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1