Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ


» Today's Birthdays

» Stats

Members: 64,923
Threads: 239,505
Posts: 2,488,592
Top Poster: JLC (31,652)
Welcome to our newest member, xxytxx
Page 1 of 3 123 LastLast
Results 1 to 10 of 25

Thread: White Snakes

  1. #1
    Registered User
    Join Date
    12-04-2017
    Location
    Durban, South Africa
    Posts
    227
    Thanks
    122
    Thanked 166 Times in 90 Posts

    White Snakes

    This is perhaps a stupid question.

    What snakes belong in the so called White Snake Maker Complex?
    I guess what I am asking is what combos produce either Snow White or Ivory Babies, this would include white snakes with reduced or very faint patterns.

    I call on all opinions.
    Ball Pythons
    1.0 Champagne Pastel
    1.0 Pastel
    1.0 Normal pos het Pied
    1.0 Spectre
    1.0 Normal
    1.0 100% het Pied
    1.0 Albino
    1.0 Fire
    0.1 Pastel Enchi
    0.1 Butter
    0.1 Fire
    0.2 Yellow Belly
    0.1 Spider
    0.1 Pastel 66% het Pied
    0.2 Normal pos het Pied
    0.1 100% het Pied
    0.5 Normal
    0.1 Pinstripe pos het Pied
    0.1 Bumblebee
    0.1 Super Pastel 66% het Axanthic
    0.1 Mystic
    0.1 Enchi

    Other Pythons
    0.0.2 Carpet Pythons

    BOAS
    1.1 Dumerils
    1.1 Red Tail
    0.0.4 Red Tail

    Corns
    2.1 Amel

  2. #2
    BPnet Veteran redshepherd's Avatar
    Join Date
    02-28-2015
    Location
    Orange County, CA
    Posts
    3,464
    Thanks
    1,930
    Thanked 3,913 Times in 1,709 Posts
    Images: 5
    Don't you mean the BEL complex? Or is there some other White Snake Complex that I don't know about LOL

    An Ivory is a super yellow belly which is unrelated to BELs.

    Quote Originally Posted by OhhWatALoser View Post
    http://www.owalreptiles.com/complexes.php

    Blue Eyed Leucistic Complex
    Butter
    Mojave
    Russo Het Leucistic
    Phantom
    Mystic
    Lesser Platinum
    Mocha
    Special
    Daddy Gene

    Black Eyed Leucistic Complex
    Fire
    Sulfur
    Last edited by redshepherd; 07-20-2018 at 04:36 AM.

    https://www.instagram.com/illusnakes/
    0.1 Tanimbar Scrub Python "Pixie", 0.1 Northern Pine Snake "Genesis"
    0.1 Dumeril's Boa "Vigil",
    0.1 2007 Aru Green Tree Python "Gem"
    1.0 Eastern Indigo "Drogon", 1.0 Blood Python "Magma"
    Ball Pythons
    0.1 Sterling "Drizzle", 1.0 Lesser Butter "Yukon", 0.1 Lesser Mojave "Snowdrift"
    past: 0.4 Ball pythons, 1.0 Russian Rat Snake



  3. The Following User Says Thank You to redshepherd For This Useful Post:

    Reptilius (07-23-2018)

  4. #3
    Registered User Sirus Uno's Avatar
    Join Date
    07-02-2018
    Location
    Kissimmee, FL.
    Posts
    79
    Thanks
    72
    Thanked 41 Times in 26 Posts
    Blue eyed leucistics: (any combo of below)
    Butter/Lesser
    Mojave
    Mocha
    Bamboo
    Russo
    Special
    Mystic/Phantom
    Daddy

    Black eyed leucistics: (any combo of below)
    Vanilla
    Fire
    Disco
    Brite
    Flame
    Sulfur
    Lemonback
    Sauce

    Mixing of black eyed and blue eyed complex genes will not produce white snakes. Only between each other in same complex.
    Last edited by Sirus Uno; 07-20-2018 at 04:49 AM.
    **LU BALLZ** (IG. @lu_ballz)
    1.1 Lesser - ZAZU & TILI
    1.0 Pastel - ACE
    1.0 Banana - DIPPER
    1.0 Pastel Yellow Belly - WU-TANG
    1.0 O.D. 100% Het. Pied - SQUANCHY
    0.1 Harlequin - HARLEEN
    0.1 Classic 100% Het. Pied - SUNNY
    0.1 Killerbee Fire - AUTUMN
    0.1 H.G.W. - KATARA
    0.1 Hypo Enchi - AMIDALA
    1.0 Beardie - LeNerd
    1.0 Mexican Red Knee Tarantula - NORI
    0.1 Children's - HAZE

  5. The Following 2 Users Say Thank You to Sirus Uno For This Useful Post:

    Reptilius (07-23-2018),Ronniex2 (07-20-2018)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    776
    Thanks
    80
    Thanked 529 Times in 292 Posts
    OWAL covers them all here:

    http://www.owalreptiles.com/complexes.php
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    Reptilius (07-23-2018)

  8. #5
    Registered User
    Join Date
    12-04-2017
    Location
    Durban, South Africa
    Posts
    227
    Thanks
    122
    Thanked 166 Times in 90 Posts
    Thank You to everyone who answered, much appreciated.
    I have a thing for pure white snakes. lol
    Ball Pythons
    1.0 Champagne Pastel
    1.0 Pastel
    1.0 Normal pos het Pied
    1.0 Spectre
    1.0 Normal
    1.0 100% het Pied
    1.0 Albino
    1.0 Fire
    0.1 Pastel Enchi
    0.1 Butter
    0.1 Fire
    0.2 Yellow Belly
    0.1 Spider
    0.1 Pastel 66% het Pied
    0.2 Normal pos het Pied
    0.1 100% het Pied
    0.5 Normal
    0.1 Pinstripe pos het Pied
    0.1 Bumblebee
    0.1 Super Pastel 66% het Axanthic
    0.1 Mystic
    0.1 Enchi

    Other Pythons
    0.0.2 Carpet Pythons

    BOAS
    1.1 Dumerils
    1.1 Red Tail
    0.0.4 Red Tail

    Corns
    2.1 Amel

  9. #6
    BPnet Lifer Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    5,290
    Thanks
    2,052
    Thanked 3,228 Times in 2,062 Posts

    White Snakes

    Quote Originally Posted by Reptilius View Post
    Thank You to everyone who answered, much appreciated.
    I have a thing for pure white snakes. lol
    Same

    I'm still looking for the Whitest White though ..

    I wonder if there's an accepted combo that gives the best WHITES ??

    There's a stunner in this forum that I keep seeing but guess lighting is always a factor ?!



    Just been reading through the Super Russo thread - interesting!



    Sent from my iPhone using Tapatalk Pro
    Last edited by Zincubus; 07-23-2018 at 07:54 AM.




  10. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    776
    Thanks
    80
    Thanked 529 Times in 292 Posts

    Re: White Snakes

    Quote Originally Posted by Zincubus View Post
    I wonder if there's an accepted combo that gives the best WHITES ??
    All-white BlkEL and/or all-white Pied combo.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following User Says Thank You to asplundii For This Useful Post:

    Zincubus (07-23-2018)

  12. #8
    BPnet Veteran Turbo Serpent's Avatar
    Join Date
    03-18-2009
    Location
    Silverdale, WA
    Posts
    1,887
    Thanks
    535
    Thanked 475 Times in 377 Posts
    Images: 1

    Re: White Snakes

    Quote Originally Posted by asplundii View Post
    All-white BlkEL and/or all-white Pied combo.
    Almost every super or ALS created from the BlkEL or BluEL has the ability to be "pure" white, but can also have pattern.

    I have seen Super Fire BlkELs that have a lot of pattern and I've seen some that were pure white, not sure what dictates the bleed through of the pattern in some but not others. The BlkEL and BlueEL complexes are fascinating because of the many different "forms." Some of them seem to be one-offs of others while some are obviously different alleles.
    Last edited by Turbo Serpent; 07-23-2018 at 12:37 PM.
    1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
    0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown

  13. #9
    Registered User hilabeans's Avatar
    Join Date
    09-26-2017
    Location
    Texas
    Posts
    923
    Thanks
    1,130
    Thanked 1,147 Times in 571 Posts
    Images: 7
    My guy is a Lesser Mojave and exceptionally clean. Although in the right lighting I do see a faint yellow dorsal stripe, not sure it that will stay faint or get more or less pronounced as he ages.

    He's striking nonetheless and seems less threatening to my snake-afeared friends somehow, but I think I prefer pattern. He's my daughter's so my next snake will be all mine and full of pattern!
    Last edited by hilabeans; 07-23-2018 at 03:35 PM.

    1.0 Lesser Mojave Ball Python "Neptune"; 1.0 Western Hognose "Murray"

    Fur Pets:

    1.0 Doberman Pinscher "Bulleit"; 1.0 Siamese Cat "Boudreaux"; 1.0 British Shorthair Cat "Oliver”

    Lizards:
    1.0 Bearded Dragon "Nigel"

    Tarantulas:
    0.1 Grammostola Rosea "Charlotte"; 0.1 Brachypelma Albopilosum "Matilda"; 0.1 Caribena Versicolor "Bijou"; 1.0 Brachypelma Boehmei "name TBD"

    Inverts:
    1.0 Emperor Scorpion "Boba"; 1.0 Spiny Flower Mantis "Hana-Louie"

    (Gone but never forgotten)

    1.0 Russian Rat Snake "Bonsai Ramen" R.I.P.
    0.1 Doberman Pinscher "Remy" R.I.P



  14. The Following User Says Thank You to hilabeans For This Useful Post:

    Ronniex2 (07-25-2018)

  15. #10
    BPnet Veteran JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,025
    Thanks
    2,000
    Thanked 2,819 Times in 1,557 Posts
    Images: 76
    I am getting ready to do a bucket of white snakes picture. Waiting on one to come out of the egg. No two of the same combo. Will be interesting to see the opinions on the "whitest".
    Honest, I only need one more ...

  16. The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:

    Reptilius (07-24-2018),Ronniex2 (07-25-2018)

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1