Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,028

2 members and 3,026 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,079
Threads: 248,525
Posts: 2,568,633
Top Poster: JLC (31,651)
Welcome to our newest member, Remarkable
Page 3 of 3 FirstFirst 123
Results 21 to 25 of 25

Thread: White Snakes

  1. #21
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: White Snakes

    Quote Originally Posted by Zincubus View Post
    Great group , great songs and he had an amazing 'spoken' voice ..
    Very 'well spoken' as I recall ..

    I still recall 'that' video featuring his super-model u


    Sent from my iPhone using Tapatalk Pro
    Yeah, they were good in a few of their incarnations.

    Left field question...
    I'm curious to hear what the rockers out there think of the band Greta van Fleet. If you don't know who they are, you should probably check them out.
    Honest, I only need one more ...

  2. #22
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    6,950
    Thanks
    2,510
    Thanked 4,898 Times in 2,993 Posts

    Re: White Snakes

    Quote Originally Posted by JodanOrNoDan View Post
    Yeah, they were good in a few of their incarnations.

    Left field question...
    I'm curious to hear what the rockers out there think of the band Greta van Fleet. If you don't know who they are, you should probably check them out.
    My colleague raves about them ... sadly I just hear them as Led Zeppelin wannabes..


    Sent from my iPhone using Tapatalk Pro




  3. #23
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: White Snakes

    Quote Originally Posted by Zincubus View Post
    My colleague raves about them ... sadly I just hear them as Led Zeppelin wannabes..


    Sent from my iPhone using Tapatalk Pro
    Yeah, same thing I said in the beginning. Zep being my all time favorite band, my reaction was "how dare you!". Then I kept listening. I finally admitted the kids were good. Even Robert acknowledged them.

    My original distaste evolved into "why not?". Zep is not going to put out anything new. Robert can still sing but not like that. I am now happy to hear that sound again and am glad there are young people playing it. If they can somehow get Mr. Page to sit behind the mixing board then we may get to hear another generation of Zep.

    And don't forget, back in the day, Coverdale was constantly accused of trying to be a Plant clone.
    Honest, I only need one more ...

  4. The Following User Says Thank You to JodanOrNoDan For This Useful Post:

    Zincubus (07-24-2018)

  5. #24
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: White Snakes

    Quote Originally Posted by Turbo Serpent View Post
    I understand, but I would love to see a genetic comparison between them, although they are allelic, maybe the strongest of them all would actually be the alleles that provide the non white supers. But again its all speculation until we could breakdown each morph to basic levels to look.
    I was not using a literal definition of strongest which is why I put quotation marks around it and defined the meaning I was using... It is not speculation to see the exact trend I pointed out. If I put a Mojave, a WT, a Lesser, and a Phantom in your hands and asked you put them in order of most to least different you would come up with Lesser : Mojave : Phantom : WT. Likewise, if I put a SuperMojave, a WT, a SuperLesser, and a SuperPhantom in your hands and asked you put them in order of most to least different you would come up with SuperLesser:SuperMojave:SuperPhantom:WT. The actual mechanism of the genetics behind it are moot, it is simply the phenotypic expression we are dealing with.


    Quote Originally Posted by JodanOrNoDan View Post
    Not only that, but it seems to be also influenced by the time of year and where they are in the shed cycle.
    Shed cycle certainly makes a difference. My Ivory gets dirtier-looking as he gets closer to shed. My SuperFire, on the other hand, gets more and more red/pink flushed as she approaches shed (I have a great pic of them side-by-side... I really need to find a new/better hosting site)


    Quote Originally Posted by JodanOrNoDan View Post
    Mojave complex BEL's hatch out light pink. I am not sure about YB or fire.
    My SuperFires had a pinkish flush to them when they hatched. My Passions, by contrast, had a more grey/blue tone to them.


    Quote Originally Posted by JodanOrNoDan View Post
    In any case, I should have enough white animals of various ages and gene combos to have a little fun with. My original "operation" was designed to make RELs in as many combos as possible. Off of the top of my head, I think I have six clutches this year that will contain white snakes.
    Depending on what you produce I may need to talk to you about adding some things to my collection... There area a couple of the Albino hetBluELs that I have been considering.


    Quote Originally Posted by Ax01 View Post
    imma just leave these two here:
    Interesting pic. Perhaps it is an artifact of the photo itself or my computer screen but that CherryBomb seems to have a slight yellow tone to it compared to the other animal (PiedLesser I am guessing based on the microphthalmia???)
    Last edited by asplundii; 07-25-2018 at 09:38 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (07-25-2018)

  7. #25
    Registered User Sirus Uno's Avatar
    Join Date
    07-02-2018
    Location
    Kissimmee, FL.
    Posts
    89
    Thanks
    84
    Thanked 45 Times in 29 Posts
    Aside from all white pieds, I thought super lesser creates the cleanest BlueEL's... though the chances of bug eyes was something that kinda deferred people from making them.
    **LU BALLZ** (IG. @lu_ballz)

Page 3 of 3 FirstFirst 123

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1