Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,130

1 members and 3,129 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,535
Posts: 2,568,703
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Page 4 of 4 FirstFirst 1234
Results 31 to 37 of 37
  1. #31
    BPnet Veteran Turbo Serpent's Avatar
    Join Date
    03-18-2009
    Location
    Silverdale, WA
    Posts
    1,841
    Thanks
    535
    Thanked 476 Times in 377 Posts
    Images: 1

    Re: So what where mom and dad?

    Quote Originally Posted by JodanOrNoDan View Post
    I have been obsessed with white BP's from the beginning. Especially the blue eyed ones, but I am working other combos including fire and yellowbelly. The only thing I have not started chasing is a white wedding.

    My end goal are cherry bomb variations (REL, red eyed leucistic). White snake + albino.
    I was just talking with my wife about REL and how they are very uncommon and nobody really tries for them anymore.

    Sent from my SM-G955U using Tapatalk
    1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
    0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown

  2. #32
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: So what where mom and dad?

    Quote Originally Posted by Turbo Serpent View Post
    I was just talking with my wife about REL and how they are very uncommon and nobody really tries for them anymore.

    Sent from my SM-G955U using Tapatalk
    LOL. Lots of years and luck go into making a REL. I am actually going to hit with my lavenders first. My normal albinos are not cooperating. In two years I will be able to produce them at will. I am waiting on 3 females to be ready. I could have hit it this year, but my girl reabsorbed.
    Honest, I only need one more ...

  3. The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:

    skydnay (07-19-2018),Turbo Serpent (07-19-2018)

  4. #33
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: So what where mom and dad?

    Quote Originally Posted by JodanOrNoDan View Post
    LOL. You don't disagree. Whole comment was "The whitest combo is Lesser x Mojave. Outside of the BEL complex Ivories can be pretty white. So can white weddings."

    Lesser x Mojave whitest BEL.
    Ah... I read your post differently.
    Quote Originally Posted by JodanOrNoDan View Post
    The whitest combo is Lesser x Mojave.
    ^^^
    This, to me, was a complete and all inclusive statement - e.g., out of all the white combos possible, the whitest combo is Lesser x Mojave.


    Quote Originally Posted by JodanOrNoDan View Post
    I agree about the dorsal, however all the phantom pins I have had do not have a dark line above the eye stripe. I have never had a jigsaw, however the ones I have seen all have a dark line above the eye stripe.
    Never noticed the line before. I will check mine at home this evening and report back.


    Quote Originally Posted by JodanOrNoDan View Post
    The whole BEL abbreviation thing confuses people and we should probably stop using it. This is why some people will use BlkEL when talking about black eyed snakes, but this isn't right either because Black Eyed white snakes can be made from 2 different complexes which are not interchangeable (yellowbelly and fire). Different pied combos can also result in a mostly white snake.
    I would note that the quality of the eye colour between BlkELs and Ivories is different so I am not sure it if fair to say you get the same phenotype from disparate complexes (and some might find it interesting to learn that neither are actually black). I use BluEL, BlkEL, Ivory, and Pied to describe the different white snakes. Blu and Blk are full complexes of animals while Ivory is a one-off within its complex and the white Pieds are all combos.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #34
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: So what where mom and dad?

    Quote Originally Posted by asplundii View Post
    Ah... I read your post differently.

    ^^^
    This, to me, was a complete and all inclusive statement - e.g., out of all the white combos possible, the whitest combo is Lesser x Mojave.




    Never noticed the line before. I will check mine at home this evening and report back.




    I would note that the quality of the eye colour between BlkELs and Ivories is different so I am not sure it if fair to say you get the same phenotype from disparate complexes (and some might find it interesting to learn that neither are actually black). I use BluEL, BlkEL, Ivory, and Pied to describe the different white snakes. Blu and Blk are full complexes of animals while Ivory is a one-off within its complex and the white Pieds are all combos.
    Yeah. We are saying the same stuff. You are just saying better.

    Its interesting what you say about the black eyed snakes. I am going to compare my Super Fire to my Ivory tonight. They look super black to me, but I am going to hit them with some light tonight.

    I think the whitest of the white may actually turn out to out to be a REL, but Ax is the only one I know of that has one. Maybe he can chime in and give some insight. It may not really count for this discussion though since we are going outside the complex to nail down the white.

    Please let me know about the eye line.
    Honest, I only need one more ...

  6. #35
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: So what where mom and dad?

    Quote Originally Posted by JodanOrNoDan View Post
    I think the whitest of the white may actually turn out to out to be a REL, but Ax is the only one I know of that has one. Maybe he can chime in and give some insight. It may not really count for this discussion though since we are going outside the complex to nail down the white.
    RELs may end up being quite white as well, but I have a feeling that RELs from BluEL group may still end up with a hint of colour bleeding through.


    Quote Originally Posted by JodanOrNoDan View Post
    Please let me know about the eye line.
    Just to make sure we are talking about the same thing with the eye line - I am reading this to mean how the lighter gold eye-stripe is basically outlined in darker brown right along the top. Is that correct? If so, then I can report that the hatchling PhantomPin, hatchling PhantomPin combo, and my breeder female PhantomPin all have the dark line.

    I would post pics but ever since Photobucket went stupid it has been too much of a hassle for me to find a now place to host pics so I can put them up. I can email you pics if you would like (hit me up via PM with your addy).
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #36
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: So what where mom and dad?

    Quote Originally Posted by asplundii View Post
    RELs may end up being quite white as well, but I have a feeling that RELs from BluEL group may still end up with a hint of colour bleeding through.




    Just to make sure we are talking about the same thing with the eye line - I am reading this to mean how the lighter gold eye-stripe is basically outlined in darker brown right along the top. Is that correct? If so, then I can report that the hatchling PhantomPin, hatchling PhantomPin combo, and my breeder female PhantomPin all have the dark line.

    I would post pics but ever since Photobucket went stupid it has been too much of a hassle for me to find a now place to host pics so I can put them up. I can email you pics if you would like (hit me up via PM with your addy).
    The phantom pin pictured here is the grandfather to the current clutch. Granted an adult, but almost no dark line above the yellow eye line. I have some known phantom pins pipping now. Should have some something to compare to of similar age. I should have kept more pictures of older clutches.
    Honest, I only need one more ...

  8. #37
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: So what where mom and dad?

    Quote Originally Posted by JodanOrNoDan View Post
    The phantom pin pictured here is the grandfather to the current clutch. Granted an adult, but almost no dark line above the yellow eye line. I have some known phantom pins pipping now. Should have some something to compare to of similar age. I should have kept more pictures of older clutches.
    Yeah, the darker line on my breeder girl is faint but it is there. However it is very distinctly there on both of my hatchlings.


    Quote Originally Posted by JodanOrNoDan View Post
    I should have kept more pictures of older clutches.
    Story of my life LOL
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (07-24-2018)

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1