» Site Navigation
1 members and 3,129 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,535
Posts: 2,568,703
Top Poster: JLC (31,651)
|
-
Re: So what where mom and dad?
Originally Posted by JodanOrNoDan
I have been obsessed with white BP's from the beginning. Especially the blue eyed ones, but I am working other combos including fire and yellowbelly. The only thing I have not started chasing is a white wedding.
My end goal are cherry bomb variations (REL, red eyed leucistic). White snake + albino.
I was just talking with my wife about REL and how they are very uncommon and nobody really tries for them anymore.
Sent from my SM-G955U using Tapatalk
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
-
Re: So what where mom and dad?
Originally Posted by Turbo Serpent
I was just talking with my wife about REL and how they are very uncommon and nobody really tries for them anymore.
Sent from my SM-G955U using Tapatalk
LOL. Lots of years and luck go into making a REL. I am actually going to hit with my lavenders first. My normal albinos are not cooperating. In two years I will be able to produce them at will. I am waiting on 3 females to be ready. I could have hit it this year, but my girl reabsorbed.
Honest, I only need one more ...
-
The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:
skydnay (07-19-2018),Turbo Serpent (07-19-2018)
-
Re: So what where mom and dad?
Originally Posted by JodanOrNoDan
LOL. You don't disagree. Whole comment was "The whitest combo is Lesser x Mojave. Outside of the BEL complex Ivories can be pretty white. So can white weddings."
Lesser x Mojave whitest BEL.
Ah... I read your post differently.
Originally Posted by JodanOrNoDan
The whitest combo is Lesser x Mojave.
^^^
This, to me, was a complete and all inclusive statement - e.g., out of all the white combos possible, the whitest combo is Lesser x Mojave.
Originally Posted by JodanOrNoDan
I agree about the dorsal, however all the phantom pins I have had do not have a dark line above the eye stripe. I have never had a jigsaw, however the ones I have seen all have a dark line above the eye stripe.
Never noticed the line before. I will check mine at home this evening and report back.
Originally Posted by JodanOrNoDan
The whole BEL abbreviation thing confuses people and we should probably stop using it. This is why some people will use BlkEL when talking about black eyed snakes, but this isn't right either because Black Eyed white snakes can be made from 2 different complexes which are not interchangeable (yellowbelly and fire). Different pied combos can also result in a mostly white snake.
I would note that the quality of the eye colour between BlkELs and Ivories is different so I am not sure it if fair to say you get the same phenotype from disparate complexes (and some might find it interesting to learn that neither are actually black). I use BluEL, BlkEL, Ivory, and Pied to describe the different white snakes. Blu and Blk are full complexes of animals while Ivory is a one-off within its complex and the white Pieds are all combos.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: So what where mom and dad?
Originally Posted by asplundii
Ah... I read your post differently.
^^^
This, to me, was a complete and all inclusive statement - e.g., out of all the white combos possible, the whitest combo is Lesser x Mojave.
Never noticed the line before. I will check mine at home this evening and report back.
I would note that the quality of the eye colour between BlkELs and Ivories is different so I am not sure it if fair to say you get the same phenotype from disparate complexes (and some might find it interesting to learn that neither are actually black). I use BluEL, BlkEL, Ivory, and Pied to describe the different white snakes. Blu and Blk are full complexes of animals while Ivory is a one-off within its complex and the white Pieds are all combos.
Yeah. We are saying the same stuff. You are just saying better.
Its interesting what you say about the black eyed snakes. I am going to compare my Super Fire to my Ivory tonight. They look super black to me, but I am going to hit them with some light tonight.
I think the whitest of the white may actually turn out to out to be a REL, but Ax is the only one I know of that has one. Maybe he can chime in and give some insight. It may not really count for this discussion though since we are going outside the complex to nail down the white.
Please let me know about the eye line.
Honest, I only need one more ...
-
-
Re: So what where mom and dad?
Originally Posted by JodanOrNoDan
I think the whitest of the white may actually turn out to out to be a REL, but Ax is the only one I know of that has one. Maybe he can chime in and give some insight. It may not really count for this discussion though since we are going outside the complex to nail down the white.
RELs may end up being quite white as well, but I have a feeling that RELs from BluEL group may still end up with a hint of colour bleeding through.
Originally Posted by JodanOrNoDan
Please let me know about the eye line.
Just to make sure we are talking about the same thing with the eye line - I am reading this to mean how the lighter gold eye-stripe is basically outlined in darker brown right along the top. Is that correct? If so, then I can report that the hatchling PhantomPin, hatchling PhantomPin combo, and my breeder female PhantomPin all have the dark line.
I would post pics but ever since Photobucket went stupid it has been too much of a hassle for me to find a now place to host pics so I can put them up. I can email you pics if you would like (hit me up via PM with your addy).
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: So what where mom and dad?
Originally Posted by asplundii
RELs may end up being quite white as well, but I have a feeling that RELs from BluEL group may still end up with a hint of colour bleeding through.
Just to make sure we are talking about the same thing with the eye line - I am reading this to mean how the lighter gold eye-stripe is basically outlined in darker brown right along the top. Is that correct? If so, then I can report that the hatchling PhantomPin, hatchling PhantomPin combo, and my breeder female PhantomPin all have the dark line.
I would post pics but ever since Photobucket went stupid it has been too much of a hassle for me to find a now place to host pics so I can put them up. I can email you pics if you would like (hit me up via PM with your addy).
The phantom pin pictured here is the grandfather to the current clutch. Granted an adult, but almost no dark line above the yellow eye line. I have some known phantom pins pipping now. Should have some something to compare to of similar age. I should have kept more pictures of older clutches.
Honest, I only need one more ...
-
-
Re: So what where mom and dad?
Originally Posted by JodanOrNoDan
The phantom pin pictured here is the grandfather to the current clutch. Granted an adult, but almost no dark line above the yellow eye line. I have some known phantom pins pipping now. Should have some something to compare to of similar age. I should have kept more pictures of older clutches.
Yeah, the darker line on my breeder girl is faint but it is there. However it is very distinctly there on both of my hatchlings.
Originally Posted by JodanOrNoDan
I should have kept more pictures of older clutches.
Story of my life LOL
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
JodanOrNoDan (07-24-2018)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|