» Site Navigation
2 members and 3,267 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,534
Posts: 2,568,702
Top Poster: JLC (31,651)
|
-
Registered User
-
-
So adorable, congratulations looks like an amazing clutch of babes thank you ever so much for sharing and best wishes always..
Domestic Short Hair - Miss Becky
Russian Blue - Church
Miniature Poodle - Pierre LaPoodlePants
Banana BP - Yuri Katsuki
-
The Following User Says Thank You to C.Marie For This Useful Post:
-
Re: Banana black pastel X purple passion ( mojave phantom )
Hard to tell because of how dark the photos are, but my guess would be Black pastel, 2x banana mojave, banana phantom, banana mojave phantom
Sent from my SM-G955U using Tapatalk
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
The Following User Says Thank You to Turbo Serpent For This Useful Post:
-
Would be easier with post-shed individual pics in better light but I am inclined to say you have a Phantom, a Banana Phantom, 2 Banana Mojave, and a Banana BlkPastel Mojave.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Banana black pastel X purple passion ( mojave phantom )
Very nice pairing.. Awesome babies..
MALES.. 1.0 Coral glow Mojave... 1.0 Coral glow Scaleless head... 1.0 Coral glow Het Pied.. 1.0 Orange dream pastel.. 1.0 Black head Pastel Rng Rg.. 1.0 Calico Yellowbelly.. FEMALES.. 0.1 Bumblebee Scaleless head.. 0.1 Black Pastel 66 Axantic.. 0.1 Leopard Lesser Pastel.. 0.1 Champange Pastel.. 0.1 Pastel Het Pied.. 0.1 Enchi… 0.1 GHI.. 0.1 Het Albino.. 0.1 Mojave.. 0.1 Normal....
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|