» Site Navigation
1 members and 1,384 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,532
Posts: 2,568,688
Top Poster: JLC (31,651)
|
-
Champagne x Ghost x Spider
I cannot find pictures of this anywhere.
Checked morph market.
Checked world of bp morph list.
Google searched.
Has this been done?
I've been gone awhile so not sure if there are other resources I am missing.
I am debating on getting a mimosa for my honeybee...
-
-
Champagne x Spider is lethal, I believe
*****
The more silent you become, the more you are able to hear...
1.0 Super Cinny Banana Het Ghost BP - "Churro"
1.0 Mack Snow Leopard Gecko
0.1 Normal Leopard Gecko
-
The Following User Says Thank You to Slicercrush For This Useful Post:
Turbo Serpent (06-05-2018)
-
Re: Champagne x Ghost x Spider
Originally Posted by Slicercrush
Champagne x Spider is lethal, I believe
You are correct.
-
The Following 2 Users Say Thank You to bcr229 For This Useful Post:
Slicercrush (06-05-2018),Turbo Serpent (06-05-2018)
-
Very sad to hear. That would explain why I haven't seen it... back to the drawing board I guess.
The spider gene needs to be mapped out so we can see what all is going on. I still feel as though it is a co-dom and the super is lethal.
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
-
Re: Champagne x Ghost x Spider
Originally Posted by Turbo Serpent
Very sad to hear. That would explain why I haven't seen it... back to the drawing board I guess.
The spider gene needs to be mapped out so we can see what all is going on. I still feel as though it is a co-dom and the super is lethal.
If you're looking for a good reference for lethal combos/gene issues, this is a good one: http://www.owalreptiles.com/issues.php
*****
The more silent you become, the more you are able to hear...
1.0 Super Cinny Banana Het Ghost BP - "Churro"
1.0 Mack Snow Leopard Gecko
0.1 Normal Leopard Gecko
-
The Following User Says Thank You to Slicercrush For This Useful Post:
Turbo Serpent (06-05-2018)
-
Re: Champagne x Ghost x Spider
Originally Posted by Turbo Serpent
I still feel as though it is a co-dom and the super is lethal.
There are a number of us who have been saying this for years... And for years we have been roundly ignored/lambasted.
OWAL did a decent write up summarizing the thoughts of us a couple years ago: http://www.owalreptiles.com/superspider.php
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Champagne x Ghost x Spider
Originally Posted by asplundii
There are a number of us who have been saying this for years... And for years we have been roundly ignored/lambasted.
OWAL did a decent write up summarizing the thoughts of us a couple years ago: http://www.owalreptiles.com/superspider.php
I just read that yesterday. Pretty good points, but like you said people have been saying it for years. Its sad that this gene affects the neurological side of the animal, because it is a beautiful display and the super, from the few I have seen that died in egg, were all pretty and silver too.
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
-
Re: Champagne x Ghost x Spider
Originally Posted by Turbo Serpent
Very sad to hear. That would explain why I haven't seen it... back to the drawing board I guess.
The spider gene needs to be mapped out so we can see what all is going on. I still feel as though it is a co-dom and the super is lethal.
I feel the same.
Wouldn’t spider HAVE to be a co-dominant trait? Since it was proven allelic to blackhead? Would that be possible if the spider gene is dominant?
edit: the jaguar gene in carpet pythons is considered to be analogous to the spider gene in ball pythons, if I’m not mistaken, with the super being a leucistic all white snake. Very similar to the supposed stillborn super spiders. This is also a lethal gene combo in carpets.
Last edited by Trisnake; 06-10-2018 at 12:29 AM.
-
The Following User Says Thank You to Trisnake For This Useful Post:
Turbo Serpent (06-11-2018)
-
Re: Champagne x Ghost x Spider
Originally Posted by Trisnake
edit: the jaguar gene in carpet pythons is considered to be analogous to the spider gene in ball pythons, if I’m not mistaken, with the super being a leucistic all white snake. Very similar to the supposed stillborn super spiders. This is also a lethal gene combo in carpets.
Nick Mutton wrote up a nice piece for HerpNation (back in 2016, when it was still functional) saying exactly this. It has been cloned here, minus pics: http://www.iherp.com/Public/Blog/Detail.aspx?uid=177785
Last edited by asplundii; 06-11-2018 at 10:23 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Champagne x Ghost x Spider
Originally Posted by Trisnake
I feel the same.
Wouldn’t spider HAVE to be a co-dominant trait? Since it was proven allelic to blackhead? Would that be possible if the spider gene is dominant?
edit: the jaguar gene in carpet pythons is considered to be analogous to the spider gene in ball pythons, if I’m not mistaken, with the super being a leucistic all white snake. Very similar to the supposed stillborn super spiders. This is also a lethal gene combo in carpets.
The way we refer to co-dom, dom and such is just how the single mutant gene looks in heterozygous and homozygous forms. Other genes have no baring on it. It being allelic proves that there is zero reason for the super spider not to exist, as the locus doesn't have any issues.
If you can make super blackheads, you can make super spiders, and ignoring all other evidence, we can still ask what's the logical conclusion based of this alone. It's lethal.
-
The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:
asplundii (06-12-2018),Slicercrush (06-12-2018)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|