Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 328

13 members and 315 guests
Most users ever online was 3,642, 05-08-2016 at 09:50 AM.


» Today's Birthdays

None

» Stats

Members: 63,112
Threads: 236,669
Posts: 2,456,270
Top Poster: JLC (31,652)
Welcome to our newest member, EmalieRaye0
Page 1 of 4 1234 LastLast
Results 1 to 10 of 31
  1. #1
    BPnet Veteran redshepherd's Avatar
    Join Date
    02-28-2015
    Location
    Orange County, CA
    Posts
    3,418
    Thanks
    1,875
    Thanked 3,781 Times in 1,675 Posts
    Images: 5

    white lipped python breeders?

    Wondering if anyone has leads to USCBB white lipped pythons?

    I rarely see CBB for sale, and I don't remember where I've seen them before either.


    0.1 Tanimbar Scrub Python "Pixie", 0.1 Northern Pine Snake "Genesis"
    0.1 Dumeril's Boa "Vigil",
    0.1 2007 Aru Green Tree Python "Gem"
    1.0 Eastern Indigo "Drogon", 1.0 Blood Python "Magma"
    Ball Pythons
    0.1 Sterling "Drizzle", 1.0 Lesser Butter "Yukon", 0.1 Lesser Mojave "Snowdrift"
    past: 0.4 Ball pythons, 1.0 Russian Rat Snake



  2. #2
    bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    7,749
    Thanks
    1,995
    Thanked 6,237 Times in 3,390 Posts
    Images: 12
    There are a few folks in the Facebook group "Awesome Liasis" who work with them. It's a great group to follow, lots of eye candy, no drama, and you can ask if anyone expects to have babies this year.

  3. The Following 2 Users Say Thank You to bcr229 For This Useful Post:

    redshepherd (05-16-2018),Team Slytherin (05-16-2018)

  4. #3
    Registered User WhompingWillow's Avatar
    Join Date
    03-24-2018
    Location
    NWI
    Posts
    432
    Thanks
    146
    Thanked 583 Times in 247 Posts
    Images: 3

    Re: white lipped python breeders?

    Quote Originally Posted by redshepherd View Post
    Wondering if anyone has leads to USCBB white lipped pythons?

    I rarely see CBB for sale, and I don't remember where I've seen them before either.
    Not sure if this is what you're looking for, but: http://reptilerapture.net/northern-w...thon-male.html

    They just posted on their FB page about a white lipped python...
    BALL PYTHONS: 1.0 Pied/Clark, 1.0 Pastel Vanilla Super Stripe/Sunny, 0.1 Dragon Fly/Buffy, 0.1 Pastel Vanilla Yellow Belly/Cher, 0.1 BEL (Mojave Lesser)/Arya, 0.0.1 Normal/Norm, 0.1 Cinnamon Enchi/Peaches, 1.0 Cinnamon Calico/Yoshi, 0.1 Pewter Het Pied & Lavender/Ariel
    BOAS: 0.1 Dumeril's Boa/Memphis, 0.1 BCL/Artemis
    CORN SNAKES: 0.0.1/Mushu
    CARPET PYTHONS: 0.1 Morelia bredli/Zelda, 0.1 Granite IJ/Bridget

  5. The Following User Says Thank You to WhompingWillow For This Useful Post:

    redshepherd (05-16-2018)

  6. #4
    BPnet Veteran redshepherd's Avatar
    Join Date
    02-28-2015
    Location
    Orange County, CA
    Posts
    3,418
    Thanks
    1,875
    Thanked 3,781 Times in 1,675 Posts
    Images: 5

    Re: white lipped python breeders?

    Quote Originally Posted by bcr229 View Post
    There are a few folks in the Facebook group "Awesome Liasis" who work with them. It's a great group to follow, lots of eye candy, no drama, and you can ask if anyone expects to have babies this year.
    Thank you, joined! Always nice to have more no drama resources.

    Quote Originally Posted by WhompingWillow View Post
    Not sure if this is what you're looking for, but: http://reptilerapture.net/northern-w...thon-male.html

    They just posted on their FB page about a white lipped python...
    Thanks, it might be! Not sure if it's CBB or not since it doesn't specify. I'm not looking at this very moment, more like for a few months ahead!
    Last edited by redshepherd; 05-16-2018 at 01:15 AM.


    0.1 Tanimbar Scrub Python "Pixie", 0.1 Northern Pine Snake "Genesis"
    0.1 Dumeril's Boa "Vigil",
    0.1 2007 Aru Green Tree Python "Gem"
    1.0 Eastern Indigo "Drogon", 1.0 Blood Python "Magma"
    Ball Pythons
    0.1 Sterling "Drizzle", 1.0 Lesser Butter "Yukon", 0.1 Lesser Mojave "Snowdrift"
    past: 0.4 Ball pythons, 1.0 Russian Rat Snake



  7. #5
    Registered User Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    712
    Thanks
    437
    Thanked 628 Times in 378 Posts
    Very hard to get them cbb, all the ones I've ever seen were import with a bad attitude and a gut full of parasites.

  8. #6
    BPnet Veteran redshepherd's Avatar
    Join Date
    02-28-2015
    Location
    Orange County, CA
    Posts
    3,418
    Thanks
    1,875
    Thanked 3,781 Times in 1,675 Posts
    Images: 5

    Re: white lipped python breeders?

    Quote Originally Posted by Alter-Echo View Post
    Very hard to get them cbb, all the ones I've ever seen were import with a bad attitude and a gut full of parasites.
    Yes, almost all of the ones commonly for sale are wild caught. But there are a few people breeding them, so I ask for leads haha


    0.1 Tanimbar Scrub Python "Pixie", 0.1 Northern Pine Snake "Genesis"
    0.1 Dumeril's Boa "Vigil",
    0.1 2007 Aru Green Tree Python "Gem"
    1.0 Eastern Indigo "Drogon", 1.0 Blood Python "Magma"
    Ball Pythons
    0.1 Sterling "Drizzle", 1.0 Lesser Butter "Yukon", 0.1 Lesser Mojave "Snowdrift"
    past: 0.4 Ball pythons, 1.0 Russian Rat Snake



  9. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    705
    Thanks
    69
    Thanked 474 Times in 259 Posts
    I believe that Ryan Young has bred them, not sure on his availability at the moment.

    And once upon a time Tom Keogan was breeding them. You might try and track him down
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    craigafrechette (05-16-2018),redshepherd (05-16-2018)

  11. #8
    BPnet Veteran craigafrechette's Avatar
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    7,039
    Thanks
    8,802
    Thanked 5,762 Times in 3,147 Posts
    I won't be any help with locating a CB white lip, but I'll be anxiously watching for updates!

    I've got a few species ahead of a WLP, but definitely on my short list. Hopefully a few years down the road when I'm ready availability will be better.

    Good luck with your search, I'll be watching closely.
    ...life is beautiful...

    "Every man dies, not every man really lives"
    - Braveheart

    "If I can't be my own, I'd feel better dead"
    - Layne Staley, Alice In Chains

  12. The Following User Says Thank You to craigafrechette For This Useful Post:

    redshepherd (05-16-2018)

  13. #9
    Registered User Phillydubs's Avatar
    Join Date
    02-04-2018
    Location
    Long Island, NY
    Posts
    1,151
    Thanks
    363
    Thanked 1,061 Times in 577 Posts
    This could be just my bad memory but there is that YouTube dude DM exotics...?

    i think his may be mostly imports but he may be breeding or know ? Just trying to help from what I recall

  14. The Following User Says Thank You to Phillydubs For This Useful Post:

    redshepherd (05-16-2018)

  15. #10
    Registered User
    Join Date
    12-16-2017
    Posts
    256
    Thanks
    4
    Thanked 292 Times in 151 Posts
    If one had WC specimens and bred them in captivity, realistically, how different would they be than the parents - on that first generation?

    Both of mine are imported, but only one has a bad attitude, the other is quite calm.
    Last edited by PiperPython; 05-16-2018 at 11:08 AM.
    Too Many...

    That's what my wife says



Page 1 of 4 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1