Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 283

12 members and 271 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

» Stats

Members: 62,188
Threads: 235,042
Posts: 2,434,335
Top Poster: JLC (31,652)
Welcome to our newest member, Garron
Page 1 of 4 1234 LastLast
Results 1 to 10 of 31
  1. #1
    BPnet Veteran redshepherd's Avatar
    Join Date
    02-28-2015
    Location
    Orange County, CA
    Posts
    3,234
    Thanks
    1,674
    Thanked 3,309 Times in 1,530 Posts
    Images: 5

    white lipped python breeders?

    Wondering if anyone has leads to USCBB white lipped pythons?

    I rarely see CBB for sale, and I don't remember where I've seen them before either.

    Other Species
    0.1 Tanimbar Scrub Python "Pixie",
    0.1 Northern Pine Snake "Genesis"
    0.1 Dumeril's Boa "Vigil",
    0.1 2007 Aru Green Tree Python "Gem"
    1.0 Blood Python "Magma"
    Ball Pythons
    0.1 Sterling "Drizzle", 1.0 Albino "Cake", 1.0 Lesser Butter "Yukon"
    past: 1.0 Russian Rat Snake, 0.3 Ball pythons



  2. #2
    bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    7,542
    Thanks
    1,891
    Thanked 5,857 Times in 3,238 Posts
    Images: 12
    There are a few folks in the Facebook group "Awesome Liasis" who work with them. It's a great group to follow, lots of eye candy, no drama, and you can ask if anyone expects to have babies this year.

  3. The Following 2 Users Say Thank You to bcr229 For This Useful Post:

    redshepherd (05-16-2018),Team Slytherin (05-16-2018)

  4. #3
    Registered User WhompingWillow's Avatar
    Join Date
    03-24-2018
    Location
    NWI
    Posts
    237
    Thanks
    33
    Thanked 277 Times in 117 Posts
    Images: 3

    Re: white lipped python breeders?

    Quote Originally Posted by redshepherd View Post
    Wondering if anyone has leads to USCBB white lipped pythons?

    I rarely see CBB for sale, and I don't remember where I've seen them before either.
    Not sure if this is what you're looking for, but: http://reptilerapture.net/northern-w...thon-male.html

    They just posted on their FB page about a white lipped python...
    末末末末末末末末末末末末末末

    Ball Pythons:
    1.0 Pied - Clark
    1.0 Pastel Vanilla Super Stripe - Sunny
    0.1 Dragon Fly - Buffy
    0.1 Pastel Vanilla Yellow Belly - Cher
    0.1 BEL ( Mojave/Lesser) - Arya
    0.0.1 Normal - Norm

    0.1 Dumeril's Boa - Memphis
    0.1 Peruvian Long-Tail Boa - Artemis
    0.0.1 Corn Snake - Mushu

  5. The Following User Says Thank You to WhompingWillow For This Useful Post:

    redshepherd (05-16-2018)

  6. #4
    BPnet Veteran redshepherd's Avatar
    Join Date
    02-28-2015
    Location
    Orange County, CA
    Posts
    3,234
    Thanks
    1,674
    Thanked 3,309 Times in 1,530 Posts
    Images: 5

    Re: white lipped python breeders?

    Quote Originally Posted by bcr229 View Post
    There are a few folks in the Facebook group "Awesome Liasis" who work with them. It's a great group to follow, lots of eye candy, no drama, and you can ask if anyone expects to have babies this year.
    Thank you, joined! Always nice to have more no drama resources.

    Quote Originally Posted by WhompingWillow View Post
    Not sure if this is what you're looking for, but: http://reptilerapture.net/northern-w...thon-male.html

    They just posted on their FB page about a white lipped python...
    Thanks, it might be! Not sure if it's CBB or not since it doesn't specify. I'm not looking at this very moment, more like for a few months ahead!
    Last edited by redshepherd; 05-16-2018 at 12:15 AM.

    Other Species
    0.1 Tanimbar Scrub Python "Pixie",
    0.1 Northern Pine Snake "Genesis"
    0.1 Dumeril's Boa "Vigil",
    0.1 2007 Aru Green Tree Python "Gem"
    1.0 Blood Python "Magma"
    Ball Pythons
    0.1 Sterling "Drizzle", 1.0 Albino "Cake", 1.0 Lesser Butter "Yukon"
    past: 1.0 Russian Rat Snake, 0.3 Ball pythons



  7. #5
    Registered User Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    703
    Thanks
    436
    Thanked 618 Times in 374 Posts
    Very hard to get them cbb, all the ones I've ever seen were import with a bad attitude and a gut full of parasites.

  8. #6
    BPnet Veteran redshepherd's Avatar
    Join Date
    02-28-2015
    Location
    Orange County, CA
    Posts
    3,234
    Thanks
    1,674
    Thanked 3,309 Times in 1,530 Posts
    Images: 5

    Re: white lipped python breeders?

    Quote Originally Posted by Alter-Echo View Post
    Very hard to get them cbb, all the ones I've ever seen were import with a bad attitude and a gut full of parasites.
    Yes, almost all of the ones commonly for sale are wild caught. But there are a few people breeding them, so I ask for leads haha

    Other Species
    0.1 Tanimbar Scrub Python "Pixie",
    0.1 Northern Pine Snake "Genesis"
    0.1 Dumeril's Boa "Vigil",
    0.1 2007 Aru Green Tree Python "Gem"
    1.0 Blood Python "Magma"
    Ball Pythons
    0.1 Sterling "Drizzle", 1.0 Albino "Cake", 1.0 Lesser Butter "Yukon"
    past: 1.0 Russian Rat Snake, 0.3 Ball pythons



  9. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    690
    Thanks
    66
    Thanked 462 Times in 250 Posts
    I believe that Ryan Young has bred them, not sure on his availability at the moment.

    And once upon a time Tom Keogan was breeding them. You might try and track him down
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    craigafrechette (05-16-2018),redshepherd (05-16-2018)

  11. #8
    Registered User craigafrechette's Avatar
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    6,354
    Thanks
    7,825
    Thanked 4,946 Times in 2,779 Posts
    I won't be any help with locating a CB white lip, but I'll be anxiously watching for updates!

    I've got a few species ahead of a WLP, but definitely on my short list. Hopefully a few years down the road when I'm ready availability will be better.

    Good luck with your search, I'll be watching closely.
    ...life is beautiful...

    "Every man dies, not every man really lives"
    - Braveheart

    "If I can't be my own, I'd feel better dead"
    - Layne Staley, Alice In Chains

  12. The Following User Says Thank You to craigafrechette For This Useful Post:

    redshepherd (05-16-2018)

  13. #9
    Registered User Phillydubs's Avatar
    Join Date
    02-04-2018
    Location
    Long Island, NY
    Posts
    1,057
    Thanks
    295
    Thanked 954 Times in 520 Posts
    This could be just my bad memory but there is that YouTube dude DM exotics...?

    i think his may be mostly imports but he may be breeding or know ? Just trying to help from what I recall

  14. The Following User Says Thank You to Phillydubs For This Useful Post:

    redshepherd (05-16-2018)

  15. #10
    Registered User
    Join Date
    12-16-2017
    Posts
    237
    Thanks
    3
    Thanked 266 Times in 139 Posts
    If one had WC specimens and bred them in captivity, realistically, how different would they be than the parents - on that first generation?

    Both of mine are imported, but only one has a bad attitude, the other is quite calm.
    Last edited by PiperPython; 05-16-2018 at 10:08 AM.
    Too Many...

    That's what my wife says



Page 1 of 4 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1