Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 394

15 members and 379 guests
Most users ever online was 3,642, 05-08-2016 at 08:50 AM.


» Today's Birthdays

None

» Stats

Members: 62,216
Threads: 235,085
Posts: 2,434,899
Top Poster: JLC (31,652)
Welcome to our newest member, joby6981
Results 1 to 9 of 9
  1. #1
    Registered User
    Join Date
    05-10-2018
    Posts
    8
    Thanks
    12
    Thanked 0 Times in 0 Posts

    Who of them is heterozygous - male or female?

    Hello.
    I really like pythons regius.
    Can you tell me: who of them is heterozygous - male or female?
    Thank you.

  2. #2
    Telling it like it is! Deborah's Avatar
    Join Date
    09-28-2006
    Posts
    22,978
    Thanks
    5,634
    Thanked 16,977 Times in 8,185 Posts
    Blog Entries
    1
    Images: 5

    Re: Who of them is heterozygous - male or female?

    Quote Originally Posted by Julia_piton View Post
    Hello.
    I really like pythons regius.
    Can you tell me: who of them is heterozygous - male or female?
    Thank you.
    Not sure about your question, both male and female can be Het.

  3. The Following User Says Thank You to Deborah For This Useful Post:

    Julia_piton (05-15-2018)

  4. #3
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    5,242
    Thanks
    2,210
    Thanked 4,847 Times in 2,777 Posts

    Re: Who of them is heterozygous - male or female?

    Quote Originally Posted by Julia_piton View Post
    Hello.
    I really like pythons regius.
    Can you tell me: who of them is heterozygous - male or female?
    Thank you.


    ^ Look! My new avatar!!

    0-4 in footballpythons.net! victors are JMarshall, tttaylorrr, Phillydubs & HighQualityBallz!!

    Wicked ones now on IG & FB!6292

    Seaside Serpents & Exotics (SSEx) clutch one, two and three.

  5. The Following User Says Thank You to Ax01 For This Useful Post:

    Julia_piton (05-15-2018)

  6. #4
    Registered User
    Join Date
    05-10-2018
    Posts
    8
    Thanks
    12
    Thanked 0 Times in 0 Posts

    x-chromosome

    I probably did not quite ask the question. And I will try to narrow it down:
    yx-chromosome: in the male or in the female bold python?
    Last edited by Julia_piton; 05-15-2018 at 07:27 PM.

  7. #5
    BPnet Veteran
    Join Date
    08-20-2016
    Location
    North of Houston, TX
    Posts
    541
    Thanks
    359
    Thanked 288 Times in 207 Posts
    Images: 1
    Female is heterozygous (zw) and male is homozygous (zz), flipped from the mammalian XY system but otherwise similar. This is how I understand it at least.

    A couple months back someone posted an article over this, I think it was in relation to parthenogenesis but I don’t remember if the study group were royal pythons or Burmese (maybe both). I will try to find the article however they’re relatively closely related species and I would assume their sex chromosomes would be assorted similarly.

    Someone correct me if I’m mistaken.
    Last edited by Trisnake; 05-15-2018 at 07:43 PM.

  8. The Following User Says Thank You to Trisnake For This Useful Post:

    Julia_piton (05-15-2018)

  9. #6
    Registered User
    Join Date
    10-12-2017
    Posts
    17
    Thanks
    15
    Thanked 12 Times in 10 Posts
    I was going to say that reptiles (including birds) have ZW females and ZZ males but there's actually a lot of variation that I didn't think about until I googled it. Apparently some reptiles use XY/XX, some do ZW/ZZ, and some rely on incubation temperature so there's a lot of options. To answer your question, as far as I can tell, all snakes are ZW/ZZ.

  10. The Following User Says Thank You to fieldfare For This Useful Post:

    Julia_piton (05-16-2018)

  11. #7
    BPnet Veteran
    Join Date
    08-20-2016
    Location
    North of Houston, TX
    Posts
    541
    Thanks
    359
    Thanked 288 Times in 207 Posts
    Images: 1
    Here’s the original post, with the linked article: https://ball-pythons.net/forums/show...Boa-and-Python

    After reviewing it again, I think I may have misunderstood the first time around. According to the study, pythons and boas exhibit an XY sex chromosome system and the females are actually homozygous XX and the males are heterozygous XY.

  12. The Following 4 Users Say Thank You to Trisnake For This Useful Post:

    Ax01 (05-16-2018),Julia_piton (05-16-2018),paulh (05-17-2018),Timelugia (05-16-2018)

  13. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    690
    Thanks
    66
    Thanked 462 Times in 250 Posts
    According to the paper put out by Dr. Warren Booth, ball pythons (and all pythons for that matter) are X/Y sex-chromosome so the females will be XX and the males will be XY


    https://docs.wixstatic.com/ugd/dfa18...9c24176674.pdf
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. The Following 6 Users Say Thank You to asplundii For This Useful Post:

    Ax01 (05-16-2018),fieldfare (05-16-2018),Julia_piton (05-16-2018),OhhWatALoser (05-17-2018),paulh (05-17-2018),Trisnake (05-18-2018)

  15. #9
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    525
    Thanks
    125
    Thanked 244 Times in 173 Posts

    Re: Who of them is heterozygous - male or female?

    Quote Originally Posted by Trisnake View Post
    ... the females are actually homozygous XX and the males are heterozygous XY.
    Better terminology would be homogametic and heterogametic. Female ball pythons are XX and therefore homogametic. Males are XY and therefore heterogametic.

  16. The Following 2 Users Say Thank You to paulh For This Useful Post:

    Ax01 (05-17-2018),Trisnake (05-18-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1