» Site Navigation
4 members and 3,511 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,537
Posts: 2,568,721
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
I have to question the ID on this animal... I know that Candy Ultramel was made in the UK a few years back and it did not have any of the pattern disruption that animal has...
Also... Why is this literal one-of-a-kind, double recessive animal priced lower than Dreamsicle or LASnows (both of which have been around for nearly a decade)?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
It's not what I expected either, much better than what I imagined. And the price is about 3x lower than it should be, a double recessive like this is a 10 year project, usually the first ones that come out sell for about $10,000.
-
-
Registered User
Re: Albino Ultramel
Originally Posted by asplundii
I have to question the ID on this animal... I know that Candy Ultramel was made in the UK a few years back and it did not have any of the pattern disruption that animal has...
Also... Why is this literal one-of-a-kind, double recessive animal priced lower than Dreamsicle or LASnows (both of which have been around for nearly a decade)?
I agree and I don't expect the next albino ultramel to look like that... there is something else going on in that snake albino dose not chance the pattern like that...
-
-
What a beautiful snake! Congrats!!
~Annie
~
-
-
Re: Albino Ultramel
Originally Posted by AnnieHeart
What a beautiful snake! Congrats!!
Very impressive.
Sent from my iPhone using Tapatalk
-
-
Re: Albino Ultramel
Originally Posted by Amos1974
I agree and I don't expect the next albino ultramel to look like that... there is something else going on in that snake albino dose not chance the pattern like that...
Exactly! The Candy Ultramel had a perfectly normal pattern and since Albino and Candy are the same gene there is no reason Albino Ultramel should have a complete and total pattern disruption like that.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Albino Ultramel
Would a lavender albino look like like this with ultramel?
-
-
Registered User
I'm in the process of making a 6 reccesive gene visual and Lavender Albino x ultramel is one of the pairings is this from a caramel albino, regular albino or a lavender albino?
-
-
Re: Albino Ultramel
Originally Posted by maculataJones
Would a lavender albino look like like this with ultramel?
I think in the intervening years that it has been pretty well accepted that this animal was not correctly labeled
A Lav Ultramel would end up looking like an incredibly pale/washed out Lav.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Albino Ultramel
Does anyone know the PROPER id of this snake
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|