Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

> FAQ

» Online Users: 3,046

0 members and 3,046 guests

No Members online

Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

Slicercrush (24)

Members: 75,079
Threads: 248,524
Posts: 2,568,620
Top Poster: JLC (31,651)

Welcome to our newest member, Remarkable

Results 31 to 31 of 31

04-19-2018, 08:22 AM #31
asplundii

View Profile

View Forum Posts

View Blog Entries

View Gallery Uploads
BPnet Veteran

Join Date

10-17-2008

Posts

906

Thanks

103

Thanked 722 Times in 382 Posts
Re: Reptilinks!!!???

Originally Posted by bcr229

Live or f/t rats?

F/T. I take the ASF juice and thaw it out enough to shake some into a snack-size Ziplock and then I place the single frozen feeder in there and drop it in the water bucket to thaw so that the scenting can permeate in.

actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Reply With Quote
The Following User Says Thank You to asplundii For This Useful Post:

bcr229 (04-19-2018)