Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,176

1 members and 1,175 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,532
Posts: 2,568,688
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Page 2 of 2 FirstFirst 12
Results 11 to 15 of 15
  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Candy ball pythons

    Quote Originally Posted by OTorresUSMC View Post
    Didn't know toffee and candy were the same. Thanks for that. I finally picked up an ultramel which overall are my favorite. If money weren't an issue id have one of so many morphs lol. I envy breeders who have the ability to own hundreds of different snake.
    Yeah... You hang around the hobby long enough and you start to hear all the origin stories. The original Toffee and Candy were brought in together in the same bag from the same shipment by an importer. The Toffee went to Craig and the Candy went to Pete (via an intermediary).

    I hear you on the "one of every morph" feeling. Been there, done that. What I have found is that once you actually get your hands on some of the morphs you are not as enthralled by them as you were when they were unattainable pictures on a screen. Find the things you are most passionate about and work on refining them.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    dakski (03-01-2018)

  3. #12
    BPnet Veteran OTorresUSMC's Avatar
    Join Date
    06-08-2016
    Location
    Upstate NY
    Posts
    307
    Thanks
    129
    Thanked 96 Times in 72 Posts
    Images: 2

    Re: Candy ball pythons

    Quote Originally Posted by asplundii View Post
    Yeah... You hang around the hobby long enough and you start to hear all the origin stories. The original Toffee and Candy were brought in together in the same bag from the same shipment by an importer. The Toffee went to Craig and the Candy went to Pete (via an intermediary).

    I hear you on the "one of every morph" feeling. Been there, done that. What I have found is that once you actually get your hands on some of the morphs you are not as enthralled by them as you were when they were unattainable pictures on a screen. Find the things you are most passionate about and work on refining them.
    I hear you there. I guess what I'm most drawn to are the more extreme color and pattern variances. Oh and full dorsals with retained side pattern. Love that. Definitely not one of every hahaha but if money were not a factor I would likely have at least 50 different snakes. For now I plan on just doing small scale breeding to combine the morphs I like. I'm sure they'll all be produced and available for sale before I produce them but there's a feeling of satisfaction in making your own lol.
    0.1 Woma Pinstripe "Gemma"
    0.1 Ultramel "Lyla"
    0.1 Bamboo Woma "Tara"
    0.1 Rio(Super Arroyo) "Wendy"
    1.0 Clown "Happy"
    1.0 Pastel Butter Ghost "Unser"
    1.0 KillerBee Yellow Belly "Half-Sack"

  4. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Candy ball pythons

    Quote Originally Posted by OTorresUSMC View Post
    I'm sure they'll all be produced and available for sale before I produce them but there's a feeling of satisfaction in making your own lol.
    Nothing more satisfying than making it yourself. I nailed Candino Womas this past season, that was an eight-year project LOL. Still much more satisfying than if I had bought them three or four years ago. Plus, as I have been selectively breeding my Albinos, Candinos, and Womas the whole time, the pair I ended up with look exactly the way I want them too and are not something I am just settling for just so I can say I have the combo.


    Quote Originally Posted by OTorresUSMC View Post
    Oh and full dorsals with retained side pattern. Love that.
    Hmmm... I may have some fun things for you in a few seasons then LOL. I have three distinct stripe projects I am working on
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #14
    BPnet Veteran OTorresUSMC's Avatar
    Join Date
    06-08-2016
    Location
    Upstate NY
    Posts
    307
    Thanks
    129
    Thanked 96 Times in 72 Posts
    Images: 2

    Re: Candy ball pythons

    Quote Originally Posted by asplundii View Post
    Nothing more satisfying than making it yourself. I nailed Candino Womas this past season, that was an eight-year project LOL. Still much more satisfying than if I had bought them three or four years ago. Plus, as I have been selectively breeding my Albinos, Candinos, and Womas the whole time, the pair I ended up with look exactly the way I want them too and are not something I am just settling for just so I can say I have the combo.




    Hmmm... I may have some fun things for you in a few seasons then LOL. I have three distinct stripe projects I am working on
    8 years??!! I hope my little projects dont take that long lol. At least my immediate ones that is. I've never been one for patience haha but I think the good thing with BP breeding is you can produce great looking animals while still on the road to your target combo. If you work with the right genes that is. The question is if the money wasn't a factor would I prefer to breed to them or just buy them. Breeding has costs all it's own but it can tend to be spread out and you can potentially recoup by selling what you dont keep. But there's the risk of not being able to sell them and having too many animals. In any event i guess the decision is made for me as I don't have the income to drop 2-5K per snake that I would want. Plus I honestly find breeding fun. I'll be interested to see what you have full dorsal wise. One of my favorite snakes right now is my female Rio. Full clean dorsal with lots of side pattern and good color changes. I'm not much for Gstripes or superstripe. Tho I recently did see a superstripe combo that added more side pattern but can't remember what was in it
    0.1 Woma Pinstripe "Gemma"
    0.1 Ultramel "Lyla"
    0.1 Bamboo Woma "Tara"
    0.1 Rio(Super Arroyo) "Wendy"
    1.0 Clown "Happy"
    1.0 Pastel Butter Ghost "Unser"
    1.0 KillerBee Yellow Belly "Half-Sack"

  6. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Candy ball pythons

    Quote Originally Posted by OTorresUSMC View Post
    8 years??!! I hope my little projects dont take that long lol.
    Yes well... I had a couple stubborn females LOL.


    Quote Originally Posted by OTorresUSMC View Post
    I'll be interested to see what you have full dorsal wise... I'm not much for Gstripes...
    Ever since PhotoBucket became jerks I kinda fell off trying to post pics but if you find me on FB you can see some of my stuff there.

    My two main stripe projects are Cypress and RedStripe/RedDevil. My other is a dinker girl that has a complete dorsal stripe that will, one day, be bred back to her son to see if it is heritable in any manner.

    I also tend to pick up or hold back animals with more prominently expressed dorsal stripes so there are a lot of striped/partial striped animals in my collection.


    Quote Originally Posted by OTorresUSMC View Post
    ...or superstripe. Tho I recently did see a superstripe combo that added more side pattern but can't remember what was in it
    If I could get hold of a breeder Specter female I have an Ivory Butter OD Pastel male that would likely make for some insane SuperStripe combos. But I am not motivated enough to buy a female Specter hatchling and raise it up for the next three years to try LOL
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1