» Site Navigation
2 members and 3,262 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,535
Posts: 2,568,703
Top Poster: JLC (31,651)
|
-
Re: Albino BP Eye Question : Slightly worried
Originally Posted by jay127
Thanks calm for adding the picture, appreciate it.
And the last link that asplundii postes is pretty much identical to what mine has. Thanks for the time in getting those pics guys.
A bit strange you've never seem them before calm, perhaps it could be the ages of the snakes you have and could certainly be only affecting newer snakes. Who knows! But again this has put my mind at ease. Bless you giys for the advice and help
I have a 2017 Albino so it just must be a certain Gene. I don't really look at all different genes of snakes and not many people have any around me..
Sent from my iPhone using Tapatalk
Name: Christian
0.1 Albino Ball (Sophie)
0.1 Russo White Diamond (Grace)
1.0 Hypo Burmese (Giacomo/AKA Jock)
1.2 Razors Edge/Gotti & American Pit Bull
----------
1.1 Albino/Normal Burmese (Mr & Mrs Snake)
1.0 Albino Ball (Sully)
-
The Following User Says Thank You to CALM Pythons For This Useful Post:
-
Re: Albino BP Eye Question : Slightly worried
Originally Posted by CALM Pythons
I think his is the same just his is more pronounced. Ive never had that in any of mine as i said.. And I certainly don't remember that being in albinos 20 years ago. here is his pic.
Originally Posted by CALM Pythons
I have a 2017 Albino so it just must be a certain Gene. I don't really look at all different genes of snakes and not many people have any around me..
It is not a the result of some other gene, all Albinos have this trait because all ball pythons have it. When Bob used to have the pics of the original Albino on his site you could see it in the pics of that animal.
If you look at the eye of any ball you will see that the top half is always a shade or two or three (or more) lighter than the bottom half because there is a pigment differential where the eye stripe passes through it. It is a bit more marked in Albinos because of the sharp contrast of their red eyes.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
CALM Pythons (02-08-2018),jay127 (02-09-2018)
-
Re: Albino BP Eye Question : Slightly worried
Originally Posted by asplundii
It is not a the result of some other gene, all Albinos have this trait because all ball pythons have it. When Bob used to have the pics of the original Albino on his site you could see it in the pics of that animal.
If you look at the eye of any ball you will see that the top half is always a shade or two or three (or more) lighter than the bottom half because there is a pigment differential where the eye stripe passes through it. It is a bit more marked in Albinos because of the sharp contrast of their red eyes.
Im looking like I'm checking for Mites and i cant find that on my albino. I can see a lighter area all around the Pupils but thats it.. Maybe its so suddle im not seeing it easily.
Sent from my iPhone using Tapatalk
Name: Christian
0.1 Albino Ball (Sophie)
0.1 Russo White Diamond (Grace)
1.0 Hypo Burmese (Giacomo/AKA Jock)
1.2 Razors Edge/Gotti & American Pit Bull
----------
1.1 Albino/Normal Burmese (Mr & Mrs Snake)
1.0 Albino Ball (Sully)
-
The Following User Says Thank You to CALM Pythons For This Useful Post:
-
Re: Albino BP Eye Question : Slightly worried
Originally Posted by asplundii
It is not a the result of some other gene, all Albinos have this trait because all ball pythons have it. When Bob used to have the pics of the original Albino on his site you could see it in the pics of that animal.
.
Just to let you know I now see it. I needed a better whiter light. Its much smaller that the OP's but definitely there.
Sent from my iPhone using Tapatalk
Name: Christian
0.1 Albino Ball (Sophie)
0.1 Russo White Diamond (Grace)
1.0 Hypo Burmese (Giacomo/AKA Jock)
1.2 Razors Edge/Gotti & American Pit Bull
----------
1.1 Albino/Normal Burmese (Mr & Mrs Snake)
1.0 Albino Ball (Sully)
-
-
Re: Albino BP Eye Question : Slightly worried
Originally Posted by CALM Pythons
Just to let you know I now see it. I needed a better whiter light. Its much smaller that the OP's but definitely there.
Yeah, the size can vary but it will always be there in some form or other.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
CALM Pythons (02-14-2018),jay127 (02-14-2018)
-
You can see the white on the nose travels down then through the eye. My snakes have these markings too. Odyn has dark brown in the bottom and cream at the top of the eye. It's pretty cool. Most snake eyes will carry the markings in their eyes.
~Sunny~
Booplesnoop Coilsome, Odyn, & Eeden AKA theLittleOne
0:1 Pastel Het Red Day Chocolate
1:0 Normal
0:0:1 Pueblan milk snake
*~* Nothing sticky (tape, stick on gauges, Velcro) goes into your enclosure! Again...NOTHING sticky goes into your enclosure....EVER! *~*
-
The Following User Says Thank You to Sunnieskys For This Useful Post:
-
Registered User
Re: Albino BP Eye Question : Slightly worried
Originally Posted by CALM Pythons
Just to let you know I now see it. I needed a better whiter light. Its much smaller that the OP's but definitely there.
Sent from my iPhone using Tapatalk
Ahh well I'm glad that clears up a lot! Yeah mine def has much more obvious marks but glad it's nothing too worrying after you guys have confirmed
Appreciate it once again!
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|