Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,264

2 members and 3,262 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,535
Posts: 2,568,703
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Page 2 of 2 FirstFirst 12
Results 11 to 17 of 17
  1. #11
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: Albino BP Eye Question : Slightly worried

    Quote Originally Posted by jay127 View Post
    Thanks calm for adding the picture, appreciate it.

    And the last link that asplundii postes is pretty much identical to what mine has. Thanks for the time in getting those pics guys.

    A bit strange you've never seem them before calm, perhaps it could be the ages of the snakes you have and could certainly be only affecting newer snakes. Who knows! But again this has put my mind at ease. Bless you giys for the advice and help
    I have a 2017 Albino so it just must be a certain Gene. I don't really look at all different genes of snakes and not many people have any around me..


    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  2. The Following User Says Thank You to CALM Pythons For This Useful Post:

    jay127 (02-09-2018)

  3. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Albino BP Eye Question : Slightly worried

    Quote Originally Posted by CALM Pythons View Post
    I think his is the same just his is more pronounced. Ive never had that in any of mine as i said.. And I certainly don't remember that being in albinos 20 years ago. here is his pic.
    Quote Originally Posted by CALM Pythons View Post
    I have a 2017 Albino so it just must be a certain Gene. I don't really look at all different genes of snakes and not many people have any around me..

    It is not a the result of some other gene, all Albinos have this trait because all ball pythons have it. When Bob used to have the pics of the original Albino on his site you could see it in the pics of that animal.

    If you look at the eye of any ball you will see that the top half is always a shade or two or three (or more) lighter than the bottom half because there is a pigment differential where the eye stripe passes through it. It is a bit more marked in Albinos because of the sharp contrast of their red eyes.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    CALM Pythons (02-08-2018),jay127 (02-09-2018)

  5. #13
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: Albino BP Eye Question : Slightly worried

    Quote Originally Posted by asplundii View Post
    It is not a the result of some other gene, all Albinos have this trait because all ball pythons have it. When Bob used to have the pics of the original Albino on his site you could see it in the pics of that animal.

    If you look at the eye of any ball you will see that the top half is always a shade or two or three (or more) lighter than the bottom half because there is a pigment differential where the eye stripe passes through it. It is a bit more marked in Albinos because of the sharp contrast of their red eyes.
    Im looking like I'm checking for Mites and i cant find that on my albino. I can see a lighter area all around the Pupils but thats it.. Maybe its so suddle im not seeing it easily.


    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  6. The Following User Says Thank You to CALM Pythons For This Useful Post:

    jay127 (02-09-2018)

  7. #14
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: Albino BP Eye Question : Slightly worried

    Quote Originally Posted by asplundii View Post
    It is not a the result of some other gene, all Albinos have this trait because all ball pythons have it. When Bob used to have the pics of the original Albino on his site you could see it in the pics of that animal.
    .
    Just to let you know I now see it. I needed a better whiter light. Its much smaller that the OP's but definitely there.



    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  8. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Albino BP Eye Question : Slightly worried

    Quote Originally Posted by CALM Pythons View Post
    Just to let you know I now see it. I needed a better whiter light. Its much smaller that the OP's but definitely there.
    Yeah, the size can vary but it will always be there in some form or other.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    CALM Pythons (02-14-2018),jay127 (02-14-2018)

  10. #16
    BPnet Senior Member Sunnieskys's Avatar
    Join Date
    05-13-2017
    Location
    Seattle, WA
    Posts
    2,471
    Thanks
    913
    Thanked 1,694 Times in 1,076 Posts
    Images: 2
    You can see the white on the nose travels down then through the eye. My snakes have these markings too. Odyn has dark brown in the bottom and cream at the top of the eye. It's pretty cool. Most snake eyes will carry the markings in their eyes.
    ~Sunny~
    Booplesnoop
    Coilsome, Odyn, & Eeden AKA theLittleOne

    0:1 Pastel Het Red Day Chocolate
    1:0 Normal
    0:0:1 Pueblan milk snake

    *~* Nothing sticky (tape, stick on gauges, Velcro) goes into your enclosure! Again...NOTHING sticky goes into your enclosure....EVER! *~*

  11. The Following User Says Thank You to Sunnieskys For This Useful Post:

    jay127 (02-14-2018)

  12. #17
    Registered User
    Join Date
    02-05-2018
    Posts
    6
    Thanks
    13
    Thanked 1 Time in 1 Post

    Re: Albino BP Eye Question : Slightly worried

    Quote Originally Posted by CALM Pythons View Post
    Just to let you know I now see it. I needed a better whiter light. Its much smaller that the OP's but definitely there.



    Sent from my iPhone using Tapatalk
    Ahh well I'm glad that clears up a lot! Yeah mine def has much more obvious marks but glad it's nothing too worrying after you guys have confirmed

    Appreciate it once again!

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1