» Site Navigation
2 members and 3,088 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,079
Threads: 248,524
Posts: 2,568,619
Top Poster: JLC (31,651)
|
-
Leopard G-stripe
Has no one made the leopard G-stripe combo? Can't find anything anywhere.
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
-
To date I have not found anyone that will admit to it...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
i haven't seen of heard about a Leo G-Stripe either.
however, a fellow forum member - Se7en (of MPS Reptiles) - did produce like a 1.1 pair of Leo Super Stripes: http://www.worldofballpythons.com/mo...r-yellow-belly i think a Leo G-Stripe would look somewhat similar but w/ more normal Leo colors.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
SKK_Reptiles (01-29-2018)
-
Did some digging and found an individual that paired a GStripe to a Leo het GS back in November, so perhaps we will see what they look like later this year...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Unfortunately, a lot of folks stopped working the GS project after the Superstripe and other YB Complex supers become more available
-
-
Re: Leopard G-stripe
Originally Posted by asplundii
Did some digging and found an individual that paired a GStripe to a Leo het GS back in November, so perhaps we will see what they look like later this year...
i look forward to it!
Originally Posted by Nussman
Unfortunately, a lot of folks stopped working the GS project after the Superstripe and other YB Complex supers become more available
sometimes there's more than one way to make a BP with G-Stripe = Super Stripe being an example. i wonder why we don't see more peeps working more genes into Disco Inferno to mimic Pied w/o working w/ recessives. Or more Red Axanthics, etc.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Re: Leopard G-stripe
Originally Posted by Ax01
i haven't seen of heard about a Leo G-Stripe either.
however, a fellow forum member - Se7en (of MPS Reptiles) - did produce like a 1.1 pair of Leo Super Stripes: http://www.worldofballpythons.com/mo...r-yellow-belly i think a Leo G-Stripe would look somewhat similar but w/ more normal Leo colors.
Those are awesome!
Originally Posted by Ax01
i look forward to it!
sometimes there's more than one way to make a BP with G-Stripe = Super Stripe being an example. i wonder why we don't see more peeps working more genes into Disco Inferno to mimic Pied w/o working w/ recessives. Or more Red Axanthics, etc.
I’ve wondered this myself many times but I’m glad not many are working with disco because I’ll be the first to make many combos. No spoilers for now but I’m working disco into quite a few never seen combos including some recessives. It will be a few years before I have visuals for those though. Could have some worlds firsts this year but only time will tell
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|