Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,234

2 members and 3,232 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,535
Posts: 2,568,706
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Results 1 to 5 of 5

Thread: Roaches

  1. #1
    BPnet Veteran Aerries's Avatar
    Join Date
    02-16-2017
    Location
    Kissimmee Fl
    Posts
    951
    Thanks
    343
    Thanked 948 Times in 460 Posts
    Images: 16

    Roaches

    Never really thought about it but what’s the best way to keep the roaches in good health? Food? Temp? Let me know I have 100 discoid coming to me tomm afternoon from Joes Bugz


    Sent from my iPhone using Tapatalk

  2. #2
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    All you need is a plastic tub 66 quarts.

    Egg crate placed vertically.

    Temps of 85/95 if you want them to breed. (can be lower if you just plan on keeping them without breeding).

    Water in the form of water crystal.

    Roach chow, ground up dog food, or this https://www.amazon.com/Repashy-Bug-B.../dp/B00DLI6H6E
    Deborah Stewart


  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I would first ask which roach you are planning on keeping as some of the caging and temp requirements will be different. For example, dubia are okay in a plastic tub but if you use that for B. lateralis you will find yourself with a suddenly empty tub... I heat my dubia, whereas room temp in the snake room is fine for my sp. Ivory. I use egg crate for my dubia, for my sp. Ivory I have a 15cm deep layer of cocopeat.

    I feed a varied diet of fruit/veggies (squash, yams, pumpkins, apples, celery, berries, carrots, bell peppers, etc.) and occasionally supplement with things like chicken feed or plain cereal. I personally disagree with the use of water crystals because they are composed of acrylamide which is a known toxin and I do not want to forward feed that to my animals. My roaches get enough moisture from the food items I give them that water for them is not necessary.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #4
    BPnet Senior Member artgecko's Avatar
    Join Date
    05-07-2009
    Location
    Georgia
    Posts
    1,699
    Thanks
    22
    Thanked 792 Times in 517 Posts
    dark plastic tub... I use a layer of packing tape around the top (inside) to prevent crawl-outs.

    Discoids are similar to dubia, which is what I have. For my dubai I keep verticle egg flats stacked and put my food / water crystals on top of the flats in dishes. I use organic chicken feed, water crystals, and fresh fruits / veggies. Watch the amount you feed them. You should only give them enough for 1-2 days then toss any leftover fresh fruits / veggies to prevent mold. Also, keep the wet food / water crystals and dry food apart.

    If you use a lid, cut a large hole in it and cover with mesh to allow for good ventilation.

    I keep a heat pad on the side of my tub and heat it to 90f for them to breed. Their room air temp is 75f or more.

    Be prepared to sift out the frass (feces) when it needs it. They will start to smell if not done often enough and can die from mold if there is too much humidity in the bin.

    If you want a breeding colony, don't feed off yours for several months and wait until you see babies of all the sizes. You will need about 1.5-8 ratio (male / female) for best results. But if you only have a few adults to start with, don't cull anyone yet as some may die due to old age, etc.
    Currently keeping:
    1.0 BCA 1.0 BCI
    1.0 CA BCI 1.1 BCLs
    0.1 BRB 1.2 KSBs
    1.0 Carpet 0.5 BPs
    0.2 cresteds 1.2 gargs
    1.0 Leachie 0.0.1 BTS

  5. #5
    BPnet Veteran Aerries's Avatar
    Join Date
    02-16-2017
    Location
    Kissimmee Fl
    Posts
    951
    Thanks
    343
    Thanked 948 Times in 460 Posts
    Images: 16

    Re: Roaches

    It’s going to be Discoid roaches, I have a sterilite bin ready to go with greens cartons and as far as heating, should I just place a heat pad on the side of the bin? Regulate it with a t-stat? My reptile room averages 80-83 degrees.


    Sent from my iPhone using Tapatalk

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1