» Site Navigation
1 members and 2,765 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,078
Threads: 248,524
Posts: 2,568,615
Top Poster: JLC (31,651)
|
-
Registered User
White Ball Pythons?
Hi all!
I’m new to the forum, semi-new to snake morphs.
I currently have a banana ball python and I am looking into getting another BP.
Thing is, I am looking for white ball pythons and I’ve seen a total of like 6 different names for them; I’ve seen: blue eyed Lucy (obviously), lesser mojave, inferno ivory, super fire, super butter...
I’m just wondering what other morphs are out there that are solid white, preferably with black eyes.
-
-
I love my ivory and she has black eyes. She is super yellow belly which is called ivory. Any combo with ivory is a super yellow belly combined with whatever other morph that is included, some are visually different than solid white but if your looking for solid white with black eyes, you can just stick with ivory.
-
The Following User Says Thank You to rufretic For This Useful Post:
-
As far as I know super fire is the only morph with black eyes and a red iris. I love the clean look of an all white snake , I'm impressed every time I pull mine out.
-
The Following User Says Thank You to Ba11er For This Useful Post:
-
Re: White Ball Pythons?
This is the only pic I have of her, I guess I need to take some better ones lol
Sent from my iPhone using Tapatalk
-
-
Registered User
I found a beautiful juvi super mojave that is white- do you guys think it will change color as it gets older?
-
-
Registered User
Re: White Ball Pythons?
Thank you Ba11er! Black eyes aren’t necessary, the main idea is the solid white- i just think the black on white looks so clean
Last edited by Taystation; 11-17-2017 at 06:11 PM.
-
-
an all white Pied is what you're looking for!
Edit: here's my Lesser Pied gurl - solid, vibrant white and black eyes. (White Weddings also look pretty much the same, different genetics of course)
Last edited by Ax01; 11-17-2017 at 06:29 PM.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
-
Ivory’s have red pupils also.
-
-
Re: White Ball Pythons?
White wedding or Black Eyed Lucy
"It does not do to dwell on dreams and forget to live"
-J.K Rowling Sorcerer's Stone
Long time no see, back at it again in my white vans.
-
-
Taystation,
The reason you are seeing a bunch of different names for "white" ball pythons is because there are many way/morph that make a "white" animal:
1) Ivory -- This is the homozygous, aka super form, of the Yellowbelly. Typically these have a faint yellow stripe down their back and some light grey/purple tint bordering the stripe and on their head. The colours can fade as they age but usually are still somewhat visible. If you add other morphs into the mix you can pull the colour away, as an example, I had an Ivory Butter Pastel that was solid white
2) Blue-Eyed Leucistic (BluEL) complex -- This is a group of related alleles where the homozygous or heteroallelic super forms are some type of BluEL. This group includes Daddy, Special, Phantom, Mystic, Mocha, Russo, Honey, Mojave, Bamboo, Butter, Lesser (and I am probably missing one or two others...) Some of these alleles are stronger than the others and, as such, generate a much whiter BluEL. As an example, a SuperPhantom is a more grey/pale animal with cream markings versus a SuperLesser which is all white.
3) Blak-Eyed Leucistic (BlkEL) complex -- Like the BluELs, this is a group of related alleles of varying strength but unlike the BluEL group, only a handful of the alleles will make a white snake in their homozygous or heteroallelic super form. The alleles that make for BlkELs are Fire, Sulfur, Lemonback, Sauce, Mota, DesertLemon, Flame and combinations between them. Some of these (Fire, Sulfur, etc) are prone to BlkELs that have a degree of yellow pattering to them. Other alleles in this group (e.g., Vanilla, Disco, Thunder, Lucifer, etc) generate hypomelanistic, pattern-disrupted superform when paired with any of the other alleles in this group
4) Pied variants -- Certain Pied combinations will throw all-white animals with some degree of frequency. Spider, hetBluEL, Champagne, Woma, BlkPastel/Cinny combinations are the most common combos for generating all-white Pieds.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Ashley96 (11-20-2017),Ax01 (11-20-2017),PitOnTheProwl (11-20-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|