» Site Navigation
1 members and 2,990 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,533
Posts: 2,568,700
Top Poster: JLC (31,651)
|
-
-
-
Happy beep! He is going to fatten up real quick.
I have a guy at work who comes in weekly for one live mouse.....I asked how old his snake is and he said 23. It's a BP. I was like one mouse? Just one? I was dumb founded. Mouth open like wha, what!
~Sunny~
Booplesnoop Coilsome, Odyn, & Eeden AKA theLittleOne
0:1 Pastel Het Red Day Chocolate
1:0 Normal
0:0:1 Pueblan milk snake
*~* Nothing sticky (tape, stick on gauges, Velcro) goes into your enclosure! Again...NOTHING sticky goes into your enclosure....EVER! *~*
-
-
Registered User
Re: Albino plus what?
I've been looking on-line and it maybe champagne or bumblebee.
-
-
Registered User
I'm thinking either albino champagne or albino bumblebee
1.0 Normal BP- Jenga
1.0 Bumblebee BP - Jynx
1.0 German Shepherd - Sif
1.1 Mixed Breed Cats - Floyd and Meanie
1.0 Suriname Red Tail Boa - Bowie
-
-
BPnet Veteran
Re: Albino plus what?
Can you take some pics in different lighting ?
Sent from my HTC6535LRA using Tapatalk
-
-
Actually at 600 grams he is big enough to breed. Usually they say 500 grams is the minimum but I've heard of them breeding even smaller, I'm actually breeding a male this year that's 450 grams, hopefully he does OK with the big girls. But at 3 years old your snake should be mature enough. If you really want to find out what is in him you should breed him to one or more normal females. All the babies will all be het for albino but all the other morphs will pop out.
Here's a big normal girl for a hundred bucks. I've had snakes this big shipped in, actual shipping is about $85, but if you find a breeder that ships a lot I've had two big snakes in one huge box shipped in for $40, some breeders have volume deals with FedEx.
https://www.morphmarket.com/us/c/rep...-pythons/97856
I actually use quite a few normal females for breeding, they are cheap and can give you a lot of info about what's in your males, not to mention if you breed them with a high end morph you can get a lot of nice babies fast. If you bred a normal with a five or six gene male you could get a rainbow of morphs.
Last edited by cchardwick; 10-22-2017 at 11:15 PM.
-
The Following User Says Thank You to cchardwick For This Useful Post:
-
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Albino plus what?
Albino spider was my first guess but I have a female albino spider and the pattern is a lot different that's why I was thinking there might be some pastel.
If you're curious there's a picture of my female in my gallery.
-
-
Re: Albino plus what?
Originally Posted by NJ Balls
Albino spider was my first guess but I have a female albino spider and the pattern is a lot different that's why I was thinking there might be some pastel.
It is possible there may be Pastel, the quality of your pic is not the best to determine from. That said... Consider that there is a great deal of variability when it comes to these animals -- not all Spiders look identical, not all Albinos look identical, not all Albino Spiders look identical. Also, consider age differences in the animals. Ontogenetic colour change can cause a shift you might not expect
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|