» Site Navigation
4 members and 1,539 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,531
Posts: 2,568,685
Top Poster: JLC (31,651)
|
-
BPnet Veteran
-
The Following 2 Users Say Thank You to fLako0aGuiiLaR For This Useful Post:
Albert Clark (10-17-2017),Godzilla78 (10-16-2017)
-
Lesser Pastel
Lesser
Leopard Lesser Pastel
SuperPastel Leopard Lesser
SuperPastel Leopard Lesser
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Multi-gene clutch help ID
Originally Posted by asplundii
Lesser Pastel
Lesser
Leopard Lesser Pastel
SuperPastel Leopard Lesser
SuperPastel Leopard Lesser
I agree with this.... Also the last one pictured is as you say a more busy patterned super pastel leopard lesser. Grats on the clutch!
Stay in peace and not pieces.
-
The Following 2 Users Say Thank You to Albert Clark For This Useful Post:
asplundii (10-18-2017),fLako0aGuiiLaR (10-20-2017)
-
BPnet Veteran
So no super in the one on top?
i thought it was a super for the little head blush :o
-
-
Re: Multi-gene clutch help ID
Originally Posted by fLako0aGuiiLaR
So no super in the one on top?
i thought it was a super for the little head blush :o
Nope, top one is not a Super. Head blushing in a Super is much more pronounced, nothing "little" about it
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Albert Clark (10-18-2017),fLako0aGuiiLaR (10-20-2017)
-
Re: Multi-gene clutch help ID
Originally Posted by asplundii
Nope, top one is not a Super. Head blushing in a Super is much more pronounced, nothing "little" about it
Just what asp. said was what i was thinking as well but wasn't really sure.
Stay in peace and not pieces.
-
The Following 2 Users Say Thank You to Albert Clark For This Useful Post:
asplundii (10-20-2017),fLako0aGuiiLaR (10-20-2017)
-
Registered User
Re: Multi-gene clutch help ID
I think only pastel lesser. No Leo.
Sent from my vivo 1601 using Tapatalk
-
The Following User Says Thank You to eldhosepp123 For This Useful Post:
-
Registered User
sorry no help from me but absolutely beautiful clutch!
-
The Following User Says Thank You to SnekDude For This Useful Post:
-
BPnet Veteran
Re: Multi-gene clutch help ID
Originally Posted by eldhosepp123
I think only pastel lesser. No Leo.
Sent from my vivo 1601 using Tapatalk
Im sure its lesser pastel leo because it looks exacly like the dad
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|