Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 655

18 members and 637 guests
Most users ever online was 4,261, 10-01-2019 at 06:44 PM.


» Today's Birthdays

» Stats

Members: 65,792
Threads: 240,508
Posts: 2,498,744
Top Poster: JLC (31,651)
Welcome to our newest member, Brandon C

View Poll Results: What's your fav complex?

Voters
67. You may not vote on this poll
  • 8-Ball

    7 10.45%
  • Albino

    8 11.94%
  • Black Eye Lucy

    7 10.45%
  • Blue Eye Lucy

    33 49.25%
  • Superstripe

    6 8.96%
  • Spider

    6 8.96%
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 29
  1. #11
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,168
    Thanks
    2,581
    Thanked 6,113 Times in 3,365 Posts

    Re: What's your favorite BP complex?

    Quote Originally Posted by cchardwick View Post
    Personally I like the pieds, the clowns, and the highway / freeway complexes, especially if you throw in the pastel.
    those recessives aren't really a complex and the Highways/Freeways are a designer morph combos from the Superstripe complex.
    ^ Look! My new avatar!!

    Wicked ones now on IG & FB!6292

    Seaside Serpents & Exotics (SSEx) clutch one, two and three.

  2. #12
    Registered User Pezz's Avatar
    Join Date
    09-20-2017
    Posts
    426
    Thanks
    21
    Thanked 196 Times in 152 Posts

    Re: What's your favorite BP complex?

    Huge Bel complex fan. Considering trying to breed one once I'm knowledgeable enough.

    I also like spiders and think bees are absolutely awesome.

    Sent from my LG-M151 using Tapatalk

  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    800
    Thanks
    83
    Thanked 561 Times in 311 Posts
    Just an FYI, Lav is not part of the Albino complex.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Ax01 (10-10-2017),yardy (11-15-2017)

  5. #14
    Registered User
    Join Date
    07-22-2012
    Posts
    33
    Thanks
    7
    Thanked 9 Times in 8 Posts

    Re: What's your favorite BP complex?

    pieds pieds and more pieds

  6. #15
    Registered User VykiC37's Avatar
    Join Date
    01-29-2017
    Location
    SC
    Posts
    11
    Thanks
    10
    Thanked 8 Times in 4 Posts

    Re: What's your favorite BP complex?

    I am definitely one for the super stripe complex. I have both a super stripe and super specter and my focus is going to be super specters. I absolutely love the striping!


    My super stripe Pixels


    My baby super specter Topaz
    FB: Scale Envy
    IG: Scale Envy

    1) 0.1 Tiger (April)
    2) 1.0 Super Stripe (Pixels)
    3) 1.0 Banana Cinnamon (Huckleberry)
    4) 1.0 Specter het Clown (Oxford)
    5) 0.1 Black Pastel Specter (Calliope)
    6) 1.0 Trick (Loki)
    7) 0.1 Cinnamon Mojave (Persephone)
    8) 1.0 Lesser (Micco)
    9) 0.1 Spotnose (Delilah)
    10) 0.1 Import (Issa)
    11) 1.0 Lori (Orion)
    12) 0.1 Specter (Clove)
    13) 0.1 Pastel Specter (Saffron)
    14) 1.0 Spotnose Vanilla (Misha)
    15) 1.0 Enchi Specter (Amaretto)
    16) 1.0 Specter Vanilla (Misha)
    17) 0.1 Pinstripe (Pickles)
    18) 0.1 Clown (Astraea)
    19) 0.1 Fire
    20) 0.1 Lesser
    21) 0.1 Pastel het Clown
    22) 0.1 Pinstripe (Pickles)
    23) 1.0 Butter Lesser Clown (Saturn)

  7. The Following 2 Users Say Thank You to VykiC37 For This Useful Post:

    Albert Clark (11-13-2017),Godzilla78 (11-11-2017)

  8. #16
    Registered User Roux's Avatar
    Join Date
    06-22-2017
    Posts
    136
    Thanks
    40
    Thanked 70 Times in 52 Posts

    Re: What's your favorite BP complex?

    B.e.l. complex for sure!
    Bamboo, mojave, mystic, lesser/butter... all my fav base morphs!

    Sent from my SM-G930V using Tapatalk

  9. #17
    Banned
    Join Date
    11-11-2017
    Posts
    11
    Thanks
    0
    Thanked 1 Time in 1 Post

    Re: What's your favorite BP complex?

    ah I misread
    Last edited by meshuga; 11-12-2017 at 07:43 AM.

  10. #18
    Registered User DavidNDC's Avatar
    Join Date
    11-02-2017
    Location
    Washington, D.C.
    Posts
    74
    Thanks
    143
    Thanked 77 Times in 37 Posts
    As a noob, I'm curious as to what defines a complex? Are they morphs that are challenging to breed or just complex combinations?

    Thanks!

  11. #19
    Eric Alan's Avatar
    Join Date
    03-01-2013
    Location
    Gilbert, AZ
    Posts
    4,511
    Thanks
    2,927
    Thanked 3,869 Times in 1,947 Posts
    Images: 1

    Re: What's your favorite BP complex?

    Quote Originally Posted by DavidNDC View Post
    As a noob, I'm curious as to what defines a complex? Are they morphs that are challenging to breed or just complex combinations?

    Thanks!
    Neither. The nice thing about BPs is that both normals and insane combinations require the exact same care.

    A "complex" is a genetics term for genes which are on the same locus as each another. We call them allelic morphs. A few examples are the BEL complex, YB complex, Fire complex, etc...
    Find me on Facebook: E.B. Ball Pythons and Instagram: @EBBallPythons

  12. The Following 3 Users Say Thank You to Eric Alan For This Useful Post:

    DavidNDC (11-12-2017),OhhWatALoser (11-13-2017),rufretic (11-12-2017)

  13. #20
    Registered User DavidNDC's Avatar
    Join Date
    11-02-2017
    Location
    Washington, D.C.
    Posts
    74
    Thanks
    143
    Thanked 77 Times in 37 Posts

    Re: What's your favorite BP complex?

    Quote Originally Posted by Eric Alan View Post
    Neither. The nice thing about BPs is that both normals and insane combinations require the exact same care.

    A "complex" is a genetics term for genes which are on the same locus as each another. We call them allelic morphs. A few examples are the BEL complex, YB complex, Fire complex, etc...
    Wow, I was way off! Thanks for the explanation!


    Sent from my iPhone using Tapatalk

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1