» Site Navigation
1 members and 1,404 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,093
Threads: 248,532
Posts: 2,568,688
Top Poster: JLC (31,651)
|
View Poll Results: What's your fav complex?
- Voters
- 67. You may not vote on this poll
-
8-Ball
-
Albino
-
Black Eye Lucy
-
Blue Eye Lucy
-
Superstripe
-
Spider
-
Re: What's your favorite BP complex?
Originally Posted by cchardwick
Personally I like the pieds, the clowns, and the highway / freeway complexes, especially if you throw in the pastel.
those recessives aren't really a complex and the Highways/Freeways are a designer morph combos from the Superstripe complex.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Re: What's your favorite BP complex?
Huge Bel complex fan. Considering trying to breed one once I'm knowledgeable enough.
I also like spiders and think bees are absolutely awesome.
Sent from my LG-M151 using Tapatalk
-
-
Just an FYI, Lav is not part of the Albino complex.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Ax01 (10-10-2017),yardy (11-15-2017)
-
Registered User
Re: What's your favorite BP complex?
pieds pieds and more pieds
-
-
Registered User
Re: What's your favorite BP complex?
I am definitely one for the super stripe complex. I have both a super stripe and super specter and my focus is going to be super specters. I absolutely love the striping!
My super stripe Pixels
My baby super specter Topaz
FB: Scale Envy
IG: Scale Envy
1) 0.1 Tiger (April)
2) 1.0 Super Specter Banana (Makai)
3) 1.0 Banana Cinnamon (Huckleberry)
4) 1.0 Specter het Clown (Oxford)
5) 0.1 Black Pastel Specter (Calliope)
6) 1.0 Trick (Loki)
7) 0.1 Cinnamon Mojave (Persephone)
8) 1.0 Lesser (Micco)
9) 0.1 Spotnose (Delilah)
10) 0.1 Import (Issa)
11) 1.0 Lori (Orion)
12) 0.1 Specter (Clove)
13) 0.1 Granite Yellow Belly (Dahlia)
14) 1.0 Spotnose Vanilla (Misha)
15) 1.0 Enchi Specter (Amaretto)
16) 1.0 Arroyo (Thorn)
17) 0.1 Pinstripe (Pickles)
18) 0.1 Arroyo (Thistle)
19) 0.1 Lesser Spotnose (Magnolia)
20) 0.1 Lesser Spotnose (Orchid)
21) 1.0 Spotnose (Pretzel)
22) 0.1 Lesser (Penelope)
23) 1.0 Calico Leopard (Asmodeus)
24) 0.1 Lori (Andromeda)
25) 1.0 Normal (Rescue)
-
The Following 2 Users Say Thank You to Scale.Envy For This Useful Post:
Albert Clark (11-13-2017),Godzilla78 (11-11-2017)
-
Registered User
Re: What's your favorite BP complex?
B.e.l. complex for sure!
Bamboo, mojave, mystic, lesser/butter... all my fav base morphs!
Sent from my SM-G930V using Tapatalk
-
-
Banned
Re: What's your favorite BP complex?
Last edited by meshuga; 11-12-2017 at 08:43 AM.
-
-
Registered User
As a noob, I'm curious as to what defines a complex? Are they morphs that are challenging to breed or just complex combinations?
Thanks!
-
-
Re: What's your favorite BP complex?
Originally Posted by DavidNDC
As a noob, I'm curious as to what defines a complex? Are they morphs that are challenging to breed or just complex combinations?
Thanks!
Neither. The nice thing about BPs is that both normals and insane combinations require the exact same care.
A "complex" is a genetics term for genes which are on the same locus as each another. We call them allelic morphs. A few examples are the BEL complex, YB complex, Fire complex, etc...
-
The Following 3 Users Say Thank You to Eric Alan For This Useful Post:
DavidNDC (11-12-2017),OhhWatALoser (11-13-2017),rufretic (11-12-2017)
-
Registered User
Re: What's your favorite BP complex?
Originally Posted by Eric Alan
Neither. The nice thing about BPs is that both normals and insane combinations require the exact same care.
A "complex" is a genetics term for genes which are on the same locus as each another. We call them allelic morphs. A few examples are the BEL complex, YB complex, Fire complex, etc...
Wow, I was way off! Thanks for the explanation!
Sent from my iPhone using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|