» Site Navigation
2 members and 2,806 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,078
Threads: 248,524
Posts: 2,568,615
Top Poster: JLC (31,651)
|
-
Maybe banana albino?? What would it even look like
This is the second year last year i got 3 albinos poss bananas did the same pairing and got 1 albino and I'm really wondering what a banana albino should look lile
Sent from my SM-G920W8 using Tapatalk
-
-
An Albino Banana looks like a 9somewhat lighter) Albino. This is not surprising because Albino strips all melanin away so the "pink" of a Banana is removed. There are a few threads here on the forum about this I believe.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Albino CG's and Banana's have been produced. Gerrick, Corey and others have produced them. i recall that clutch of yours. i remember u thinking that u thought the Albino Banana's were all pink, patternless when u cut the eggs. but they all ended up with patterns anyway.
as asplundii and others have mentioned, they look like regular albino's. besides the freckles, Banana's are pretty much color morphs. as for the freckles appearing in Albino Banana's, they would not as the Albinism would eliminate all the black from the start. your best bet is to hold one back and prove it out (or breed a Super Banana het Albino to another Albino).
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
-
Registered User
Re: Maybe banana albino?? What would it even look like
Theoretically, you might be able to tell if it's a banana based on the sex of the hatchling as well. For example, if you're breeding a male maker banana het. albino then almost all male babies would have the banana gene, except on the chance that you hit the very slim odds of producing a female banana. In male maker banana clutches all non-banana offspring are (usually) females.
-
The Following User Says Thank You to mwolf For This Useful Post:
nightwolfsnow (09-26-2017)
-
Re: Maybe banana albino?? What would it even look like
I haven't heard of any of them producing them but thanks I'll hit him up with a pm and see if he can help as I love watching gerricks YouTube
Sent from my SM-G920W8 using Tapatalk
-
-
Re: Maybe banana albino?? What would it even look like
Originally Posted by asplundii
An Albino Banana looks like a 9somewhat lighter) Albino. This is not surprising because Albino strips all melanin away so the "pink" of a Banana is removed. There are a few threads here on the forum about this I believe.
Lol probs me asking as I did this last year aswell it's something I'm really wanting to make but slowly thinking it's going to be a long haul but all but 1 albinos from the 2 clutches were males so if it's a sex linked thing aswell then I may have sold a few as normal albinos lol and 1 super faded albino
Sent from my SM-G920W8 using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|