Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,232

1 members and 3,231 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,093
Threads: 248,533
Posts: 2,568,700
Top Poster: JLC (31,651)
Welcome to our newest member, Amethyst42
Page 3 of 4 FirstFirst 1234 LastLast
Results 21 to 30 of 39
  1. #21
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Lavender Albino or not?

    Quote Originally Posted by Albert Clark View Post
    This is one of the Candinos that I hatched out August 23, '17. Notice the darker ruby eye color.
    Notice that the animal's entire head is in shadow which makes they eye appear darker than it actually is.

    I have hatched Candino clutches the past three years, the eyes on Candinos as hatchlings are not noticeably different than the eyes of their Albino siblings. Further, as they mature, Candino eyes do not look like the one in the OP's picture.

    Quote Originally Posted by piedpiperballs View Post
    My best theory as to what morph the black eyed baby is as follows: The parents are by coincidence both het for Axanthic and the black eyed baby and one of the two normal babies to me display this gene
    With all due respect, that is not how it works. Axanthic pulls yellow out while Lav drops the melanin. Neither of these conditions act to darken the eye. Hatchling LavSnows have red eyes the same as straight Lavs. As the animals age theirs eyes become a deeper claret-colour.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #22
    BPnet Lifer Albert Clark's Avatar
    Join Date
    02-22-2015
    Location
    Spotsylvania, Va.
    Posts
    4,650
    Thanks
    6,518
    Thanked 3,295 Times in 2,139 Posts
    Images: 39

    Re: Lavender Albino or not?

    Quote Originally Posted by asplundii View Post
    Notice that the animal's entire head is in shadow which makes they eye appear darker than it actually is.

    I have hatched Candino clutches the past three years, the eyes on Candinos as hatchlings are not noticeably different than the eyes of their Albino siblings. Further, as they mature, Candino eyes do not look like the one in the OP's picture.



    With all due respect, that is not how it works. Axanthic pulls yellow out while Lav drops the melanin. Neither of these conditions act to darken the eye. Hatchling LavSnows have red eyes the same as straight Lavs. As the animals age theirs eyes become a deeper claret-colour.
    Well that clearly is your position but we all can write our anecdotal findings when it comes to breeding and the visible differences in productions. While I respect your position I disagree with the statement on the way a particular hatchling may present based on a preconceived idea of breeding results over time. You can go on Morph market and view the multitude of hatchling Candinos and compare them to albinos and see in some of them ruby eye coloration is visible. Moreso in some than in others. Genetics is not a exact science and different outcomes and appearances can and do happen.
    Last edited by Albert Clark; 09-25-2017 at 12:39 PM.
    Stay in peace and not pieces.

  3. #23
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: Lavender Albino or not?

    Quote Originally Posted by piedpiperballs View Post
    My best theory as to what morph the black eyed baby is as follows: The parents are by coincidence both het for Axanthic and the black eyed baby and one of the two normal babies to me display this gene. As for explaining the black eyes on the oddly colored lavender albino baby I have found photos of axanthic lavender albino balls with both black and red eyes. I'll post more photos as the baby matures. I have an adult female pied that surprisingly proved to be het for albino when I bred her with a male albino het for pied. I believe many of our ball pythons carry genes from previous generations being bred to recessive animals and babies were unknowingly het for these recessive traits and never proven out. Thanks for everyone's input on this puzzle.
    what marker(s) do u see in the normal that indicates it may be het Axanthic? pix?

    also i think i inadvertently planted the seed in your head to make u think it may be a Lavender Albino Snow when i drew comparison to the eyes of the Lavender Albino Snow in the other thread. i think your's has too many yellows to be a Snow. it should be more of a high white pattern with hints of yellow on a lavender background.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  4. #24
    Registered User
    Join Date
    10-01-2015
    Posts
    49
    Thanks
    7
    Thanked 52 Times in 18 Posts

    Re: Lavender Albino or not?

    Quote Originally Posted by Ax01 View Post
    what marker(s) do u see in the normal that indicates it may be het Axanthic? pix?

    also i think i inadvertently planted the seed in your head to make u think it may be a Lavender Albino Snow when i drew comparison to the eyes of the Lavender Albino Snow in the other thread. i think your's has too many yellows to be a Snow. it should be more of a high white pattern with hints of yellow on a lavender background.
    Axanthic - While albinism is the lack of all melanin or pigment color, Axanthics only lack red or yellow or both. Axanthics are a recessive mutation that produces a snake that is varying shades of grey, black and brown.

    I think that one of the normals babies looks to be Axanthic and the lavender albino baby as well. As for the dark eyes on the Lavender Albino see the definition above that states Axanthics can lack both yellow and red.

  5. #25
    BPnet Veteran Alicia's Avatar
    Join Date
    07-22-2010
    Location
    Pacific NW
    Posts
    518
    Thanks
    3,668
    Thanked 423 Times in 269 Posts
    Images: 1

    Re: Lavender Albino or not?

    Quote Originally Posted by piedpiperballs View Post
    Axanthic - While albinism is the lack of all melanin or pigment color, Axanthics only lack red or yellow or both. Axanthics are a recessive mutation that produces a snake that is varying shades of grey, black and brown.

    I think that one of the normals babies looks to be Axanthic and the lavender albino baby as well. As for the dark eyes on the Lavender Albino see the definition above that states Axanthics can lack both yellow and red.
    I need to note, red eyes on an albino are not the result of red pigment. They are the result of the melanin (and other pigments) in the eye being stripped away to review the capillaries beneath. The red color is derived from the animal's now-visible hemoglobin.

    That said, I don't have an explanation for the weird, dark-eyed baby, except that it's a lavender albino with its color switched on early. Maybe due to poly genetic factors, maybe due to simple modifiers. Probably the only way to know is to hold the little guy back and breed it. It doesn't look like a lavender snow to me, though. The eyes of a lavender snow are bright ruby-scarlet, and the blotches are noticeably paler on a lav snow than your little guy. Am I saying it can't be? No, I can't. I just call it as it looks on my screen.

    The almost greyish baby doesn't quite look axanthic, at least not on my monitor. What it reminds me of, is something that used to be seen from time to time with the old-school faded albinos. The hets would often hatch out looking very axanthic, then color up after a couple sheds. This was a visible marker for the faded trait. Maybe the separate gene(s) for fading got mixed into your lavs somewhere along the line, and the dark-eyed guy is a result?

    Anyway. Two cents. Best,

  6. The Following 3 Users Say Thank You to Alicia For This Useful Post:

    Albert Clark (10-02-2017),piedpiperballs (09-27-2017),tttaylorrr (10-10-2017)

  7. #26
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Lavender Albino or not?

    Quote Originally Posted by piedpiperballs View Post
    Axanthic - While albinism is the lack of all melanin or pigment color, Axanthics only lack red or yellow or both. Axanthics are a recessive mutation that produces a snake that is varying shades of grey, black and brown.

    I think that one of the normals babies looks to be Axanthic and the lavender albino baby as well. As for the dark eyes on the Lavender Albino see the definition above that states Axanthics can lack both yellow and red.
    Axanthism is only a lack of yellow pigment, the lack of red pigment is anerythrism. Also, there is no red pigmentation in ball pythons, hence the reason Albino balls are only yellow and white

    As Alicia noted, the red in Albino eyes is not derived from a pigment it is the result of the blood and the crystalline structure of the eye. This is why the Snow and LavSnow combos also have red eyes.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #27
    Registered User Ballpythonguy92's Avatar
    Join Date
    11-20-2016
    Posts
    393
    Thanks
    214
    Thanked 115 Times in 91 Posts

    Re: Lavender Albino or not?

    I want to say candino as well but it's pattern and color looks off same with the eyes look way darker buy either way amazing

    Sent from my SM-G920W8 using Tapatalk

  9. #28
    Registered User
    Join Date
    10-01-2015
    Posts
    49
    Thanks
    7
    Thanked 52 Times in 18 Posts

    Re: Lavender Albino or not?

    Quote Originally Posted by Ballpythonguy92 View Post
    I want to say candino as well but it's pattern and color looks off same with the eyes look way darker buy either way amazing

    Sent from my SM-G920W8 using Tapatalk
    Here is a photo after first shed.

    Sent from my LG-D415 using Tapatalk

  10. #29
    BPnet Veteran BluuWolf's Avatar
    Join Date
    07-08-2017
    Posts
    564
    Thanks
    143
    Thanked 395 Times in 276 Posts

    Re: Lavender Albino or not?

    It looks like a banana to me lol but I'm far from an expert

    Sent from my LG-D690 using Tapatalk

  11. #30
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: Lavender Albino or not?

    Quote Originally Posted by piedpiperballs View Post
    Here is a photo after first shed.

    Sent from my LG-D415 using Tapatalk
    Quote Originally Posted by BluuWolf View Post
    It looks like a banana to me lol but I'm far from an expert
    well this has been an interesting couple of threads! is that a freckle? what if u had an Albino Banana/Coral Glow all along? this is just crazy. ballpythonguy92 is gonna flip.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1